Mutagenetix > Incidental Mutation

Incidental Mutation 'R5295:Arhgef1'

405356

Institutional Source

Beutler Lab

Gene Symbol

Arhgef1

Ensembl Gene

ENSMUSG00000040940

Gene Name

Rho guanine nucleotide exchange factor (GEF) 1

Synonyms

Lbcl2, Lsc

MMRRC Submission

042878-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.508) question?

Stock #

R5295 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

24902912-24926594 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (1 bp from exon)

DNA Base Change (assembly)

G to A at 24919352 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000117008 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047873] [ENSMUST00000098683] [ENSMUST00000117419] [ENSMUST00000117796] [ENSMUST00000132751] [ENSMUST00000132751] [ENSMUST00000205295] [ENSMUST00000206508]

AlphaFold

Q61210

Predicted Effect

probably benign
Transcript: ENSMUST00000047873

SMART Domains

Protein: ENSMUSP00000046469
Gene: ENSMUSG00000040940

Domain	Start	End	E-Value	Type
low complexity region	5	13	N/A	INTRINSIC
Pfam:RGS-like	40	230	1.3e-72	PFAM
low complexity region	380	400	N/A	INTRINSIC
RhoGEF	419	603	1.87e-63	SMART
PH	647	761	4.68e-5	SMART
low complexity region	845	864	N/A	INTRINSIC
coiled coil region	867	890	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000098683

SMART Domains

Protein: ENSMUSP00000096280
Gene: ENSMUSG00000040940

Domain	Start	End	E-Value	Type
low complexity region	5	13	N/A	INTRINSIC
Pfam:RGS-like	40	230	2.2e-78	PFAM
PDB:3ODW\|B	238	384	2e-57	PDB
low complexity region	396	412	N/A	INTRINSIC
low complexity region	439	459	N/A	INTRINSIC
RhoGEF	478	662	1.87e-63	SMART
PH	706	820	4.68e-5	SMART
low complexity region	904	923	N/A	INTRINSIC
coiled coil region	926	949	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000117419

SMART Domains

Protein: ENSMUSP00000113366
Gene: ENSMUSG00000040940

Domain	Start	End	E-Value	Type
low complexity region	5	13	N/A	INTRINSIC
Pfam:RGS-like	40	230	1.3e-72	PFAM
low complexity region	380	400	N/A	INTRINSIC
RhoGEF	419	603	1.87e-63	SMART
PH	647	761	4.68e-5	SMART
low complexity region	845	864	N/A	INTRINSIC
coiled coil region	867	890	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000117796

SMART Domains

Protein: ENSMUSP00000113771
Gene: ENSMUSG00000040940

Domain	Start	End	E-Value	Type
low complexity region	5	13	N/A	INTRINSIC
Pfam:RGS-like	40	230	7.3e-73	PFAM
low complexity region	393	409	N/A	INTRINSIC
low complexity region	436	456	N/A	INTRINSIC
RhoGEF	475	659	1.87e-63	SMART
PH	703	817	4.68e-5	SMART
low complexity region	901	920	N/A	INTRINSIC
coiled coil region	923	946	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126484

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126918

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129928

Predicted Effect

probably null
Transcript: ENSMUST00000132751

SMART Domains

Protein: ENSMUSP00000117008
Gene: ENSMUSG00000040940

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
low complexity region	70	89	N/A	INTRINSIC
low complexity region	97	113	N/A	INTRINSIC
low complexity region	140	160	N/A	INTRINSIC
RhoGEF	179	363	1.87e-63	SMART
PH	407	521	4.68e-5	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000132751

SMART Domains

Protein: ENSMUSP00000117008
Gene: ENSMUSG00000040940

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
low complexity region	70	89	N/A	INTRINSIC
low complexity region	97	113	N/A	INTRINSIC
low complexity region	140	160	N/A	INTRINSIC
RhoGEF	179	363	1.87e-63	SMART
PH	407	521	4.68e-5	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132786

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000144714

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145783

Predicted Effect

probably benign
Transcript: ENSMUST00000205295

Predicted Effect

probably benign
Transcript: ENSMUST00000206508

Meta Mutation Damage Score

0.8893

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rho GTPases play a fundamental role in numerous cellular processes that are initiated by extracellular stimuli that work through G protein coupled receptors. The encoded protein may form complex with G proteins and stimulate Rho-dependent signals. Multiple alternatively spliced transcript variants have been found for this gene, but the full-length nature of some variants has not been defined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in impaired humeral immunity, reduced numbers of marginal zone B (MZB) cells, decreased basal T cell proliferation, and reduced basal motility of lymphocytes but enhanced migration of MZB cells after serum activation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 39 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Alpk2	C	T	18: 65,305,038	E1095K	probably damaging	Het
Alpl	T	C	4: 137,749,608	T245A	probably benign	Het
Ank2	T	C	3: 127,032,183	H378R	probably damaging	Het
Atp5c1	T	C	2: 10,068,733	R10G	possibly damaging	Het
Cbln3	T	C	14: 55,883,463		probably null	Het
Ccr10	C	T	11: 101,174,285	V140M	possibly damaging	Het
Cep135	T	A	5: 76,593,204	H42Q	possibly damaging	Het
Commd5	C	A	15: 76,900,952	T183K	possibly damaging	Het
Dnajc16	T	C	4: 141,767,928	E493G	possibly damaging	Het
Ears2	T	C	7: 122,048,198	R288G	probably damaging	Het
Elovl4	G	A	9: 83,780,661	P273L	possibly damaging	Het
Fam186b	T	A	15: 99,283,874	I148F	probably damaging	Het
Fryl	T	C	5: 73,112,791	Y79C	probably damaging	Het
Gad1-ps	A	G	10: 99,444,889		noncoding transcript	Het
Gm14325	G	A	2: 177,832,984	H102Y	possibly damaging	Het
Gm8882	T	G	6: 132,361,877	Q126P	unknown	Het
Ighv1-77	T	A	12: 115,861,908	S104C	probably damaging	Het
Kcnv1	T	C	15: 45,114,591	D17G	unknown	Het
Lmtk3	G	A	7: 45,791,298	D243N	probably damaging	Het
Lrrc7	T	A	3: 158,170,739	K571N	probably damaging	Het
Lsm7	T	C	10: 80,854,620	E32G	probably damaging	Het
Ly6f	A	G	15: 75,271,639	Q65R	probably benign	Het
Perm1	T	C	4: 156,217,518	L173P	probably benign	Het
Plvap	T	C	8: 71,511,670	Q16R	probably benign	Het
Prl7d1	A	T	13: 27,709,247	V227D	probably damaging	Het
Prss54	T	C	8: 95,564,478	T165A	probably damaging	Het
Psrc1	A	G	3: 108,386,359	I195V	probably benign	Het
Rnf123	AT	ATT	9: 108,064,003		probably null	Het
Rnf213	A	T	11: 119,440,816	T2284S	probably benign	Het
Serpina3c	T	C	12: 104,148,378	E333G	probably damaging	Het
Serpinb6c	A	G	13: 33,893,817	F190S	probably damaging	Het
Sfmbt1	G	A	14: 30,774,029	D90N	probably damaging	Het
Tdh	T	C	14: 63,496,109	Y110C	probably damaging	Het
Tdrd9	T	A	12: 112,051,912	L1255*	probably null	Het
Trim41	TTCCTCCTCCTCCTCCTCCTCCTCCTCC	TTCCTCCTCCTCCTCCTCCTCCTCC	11: 48,816,257		probably benign	Het
Vps51	T	G	19: 6,071,033	E283D	probably benign	Het
Zbtb2	T	C	10: 4,368,508	K506R	probably damaging	Het
Zmiz1	T	C	14: 25,656,347	L800P	probably damaging	Het
Znhit6	A	G	3: 145,600,493	D251G	probably benign	Het

Other mutations in Arhgef1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00421:Arhgef1	APN	7	24908359	missense	possibly damaging	0.93
IGL00901:Arhgef1	APN	7	24912693	missense	probably damaging	1.00
IGL01139:Arhgef1	APN	7	24925951	unclassified	probably benign
IGL01479:Arhgef1	APN	7	24912603	missense	probably benign	0.01
IGL01935:Arhgef1	APN	7	24921882	missense	probably damaging	1.00
IGL01944:Arhgef1	APN	7	24925783	critical splice acceptor site	probably null
IGL02032:Arhgef1	APN	7	24923371	missense	probably benign	0.23
IGL02059:Arhgef1	APN	7	24912552	splice site	probably benign
IGL02202:Arhgef1	APN	7	24913429	nonsense	probably null
IGL02324:Arhgef1	APN	7	24923815	missense	probably damaging	1.00
IGL02328:Arhgef1	APN	7	24923815	missense	probably damaging	1.00
IGL03027:Arhgef1	APN	7	24923732	missense	probably damaging	0.98
IGL03227:Arhgef1	APN	7	24922851	missense	probably damaging	1.00
IGL03404:Arhgef1	APN	7	24916843	missense	probably benign	0.07
BB009:Arhgef1	UTSW	7	24919710	missense	probably damaging	1.00
BB019:Arhgef1	UTSW	7	24919710	missense	probably damaging	1.00
R0082:Arhgef1	UTSW	7	24912605	nonsense	probably null
R0277:Arhgef1	UTSW	7	24923799	unclassified	probably benign
R0336:Arhgef1	UTSW	7	24921957	missense	possibly damaging	0.77
R0494:Arhgef1	UTSW	7	24919360	intron	probably benign
R0668:Arhgef1	UTSW	7	24907920	missense	possibly damaging	0.63
R1520:Arhgef1	UTSW	7	24919704	missense	probably damaging	1.00
R1531:Arhgef1	UTSW	7	24924998	missense	probably damaging	0.99
R1656:Arhgef1	UTSW	7	24913632	missense	probably damaging	1.00
R2979:Arhgef1	UTSW	7	24907751	missense	unknown
R3855:Arhgef1	UTSW	7	24919272	missense	probably damaging	1.00
R3856:Arhgef1	UTSW	7	24919272	missense	probably damaging	1.00
R4080:Arhgef1	UTSW	7	24925846	missense	probably damaging	0.96
R4081:Arhgef1	UTSW	7	24925846	missense	probably damaging	0.96
R4583:Arhgef1	UTSW	7	24912571	missense	probably benign	0.09
R4750:Arhgef1	UTSW	7	24918576	intron	probably benign
R4914:Arhgef1	UTSW	7	24923839	missense	probably damaging	1.00
R5255:Arhgef1	UTSW	7	24925022	missense	probably damaging	1.00
R5275:Arhgef1	UTSW	7	24919352	critical splice donor site	probably null
R5430:Arhgef1	UTSW	7	24912307	splice site	probably null
R5604:Arhgef1	UTSW	7	24912785	missense	probably benign	0.09
R6150:Arhgef1	UTSW	7	24919357	splice site	probably null
R6151:Arhgef1	UTSW	7	24917942	missense	probably benign	0.00
R6788:Arhgef1	UTSW	7	24919780	splice site	probably null
R6943:Arhgef1	UTSW	7	24923731	missense	probably benign	0.01
R6988:Arhgef1	UTSW	7	24916923	missense	probably benign	0.04
R7422:Arhgef1	UTSW	7	24916036	missense	probably benign	0.00
R7701:Arhgef1	UTSW	7	24912578	missense	probably benign	0.01
R7706:Arhgef1	UTSW	7	24916881	missense	probably damaging	1.00
R7707:Arhgef1	UTSW	7	24916881	missense	probably damaging	1.00
R7708:Arhgef1	UTSW	7	24916881	missense	probably damaging	1.00
R7932:Arhgef1	UTSW	7	24919710	missense	probably damaging	1.00
R7967:Arhgef1	UTSW	7	24916881	missense	probably damaging	1.00
R7970:Arhgef1	UTSW	7	24916881	missense	probably damaging	1.00
R7995:Arhgef1	UTSW	7	24919216	missense	probably damaging	0.99
R8029:Arhgef1	UTSW	7	24919738	missense	probably damaging	1.00
R8132:Arhgef1	UTSW	7	24907662	intron	probably benign
R8132:Arhgef1	UTSW	7	24919749	nonsense	probably null
R8168:Arhgef1	UTSW	7	24925406	missense	probably benign	0.06
R8964:Arhgef1	UTSW	7	24923037	missense	probably damaging	1.00
R9114:Arhgef1	UTSW	7	24907879	missense	probably damaging	1.00
R9553:Arhgef1	UTSW	7	24919690	missense	probably damaging	1.00
R9676:Arhgef1	UTSW	7	24926076	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- AGGCTATCAGGGCGTCTAGG -3'
(R):5'- CACTGTTAAGCTCCATCCTGG -3'

Sequencing Primer
(F):5'- TCTAGGGCGCTCAGAGAG -3'
(R):5'- AGTTACAAGCCCTCTGTGGC -3'

Posted On

2016-07-22