Incidental Mutation 'R5295:Ears2'
ID405358
Institutional Source Beutler Lab
Gene Symbol Ears2
Ensembl Gene ENSMUSG00000030871
Gene Nameglutamyl-tRNA synthetase 2, mitochondrial
Synonyms3230401I01Rik
MMRRC Submission 042878-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5295 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location122037213-122067263 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 122048198 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 288 (R288G)
Ref Sequence ENSEMBL: ENSMUSP00000033159 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033159]
Predicted Effect probably damaging
Transcript: ENSMUST00000033159
AA Change: R288G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000033159
Gene: ENSMUSG00000030871
AA Change: R288G

DomainStartEndE-ValueType
Pfam:tRNA-synt_1c 36 353 3.5e-88 PFAM
low complexity region 448 460 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147397
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151530
Meta Mutation Damage Score 0.9717 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a putative member of the class I family of aminoacyl-tRNA synthetases. These enzymes play a critical role in protein biosynthesis by charging tRNAs with their cognate amino acids. This protein is encoded by the nuclear genome but is likely to be imported to the mitochondrion where it is thought to catalyze the ligation of glutamate to tRNA molecules. Mutations in a similar gene in human have been associated with combined oxidative phosphorylation deficiency 12 (COXPD12). [provided by RefSeq, Mar 2015]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alpk2 C T 18: 65,305,038 E1095K probably damaging Het
Alpl T C 4: 137,749,608 T245A probably benign Het
Ank2 T C 3: 127,032,183 H378R probably damaging Het
Arhgef1 G A 7: 24,919,352 probably null Het
Atp5c1 T C 2: 10,068,733 R10G possibly damaging Het
Cbln3 T C 14: 55,883,463 probably null Het
Ccr10 C T 11: 101,174,285 V140M possibly damaging Het
Cep135 T A 5: 76,593,204 H42Q possibly damaging Het
Commd5 C A 15: 76,900,952 T183K possibly damaging Het
Dnajc16 T C 4: 141,767,928 E493G possibly damaging Het
Elovl4 G A 9: 83,780,661 P273L possibly damaging Het
Fam186b T A 15: 99,283,874 I148F probably damaging Het
Fryl T C 5: 73,112,791 Y79C probably damaging Het
Gad1-ps A G 10: 99,444,889 noncoding transcript Het
Gm14325 G A 2: 177,832,984 H102Y possibly damaging Het
Gm8882 T G 6: 132,361,877 Q126P unknown Het
Ighv1-77 T A 12: 115,861,908 S104C probably damaging Het
Kcnv1 T C 15: 45,114,591 D17G unknown Het
Lmtk3 G A 7: 45,791,298 D243N probably damaging Het
Lrrc7 T A 3: 158,170,739 K571N probably damaging Het
Lsm7 T C 10: 80,854,620 E32G probably damaging Het
Ly6f A G 15: 75,271,639 Q65R probably benign Het
Perm1 T C 4: 156,217,518 L173P probably benign Het
Plvap T C 8: 71,511,670 Q16R probably benign Het
Prl7d1 A T 13: 27,709,247 V227D probably damaging Het
Prss54 T C 8: 95,564,478 T165A probably damaging Het
Psrc1 A G 3: 108,386,359 I195V probably benign Het
Rnf123 AT ATT 9: 108,064,003 probably null Het
Rnf213 A T 11: 119,440,816 T2284S probably benign Het
Serpina3c T C 12: 104,148,378 E333G probably damaging Het
Serpinb6c A G 13: 33,893,817 F190S probably damaging Het
Sfmbt1 G A 14: 30,774,029 D90N probably damaging Het
Tdh T C 14: 63,496,109 Y110C probably damaging Het
Tdrd9 T A 12: 112,051,912 L1255* probably null Het
Trim41 TTCCTCCTCCTCCTCCTCCTCCTCCTCC TTCCTCCTCCTCCTCCTCCTCCTCC 11: 48,816,257 probably benign Het
Vps51 T G 19: 6,071,033 E283D probably benign Het
Zbtb2 T C 10: 4,368,508 K506R probably damaging Het
Zmiz1 T C 14: 25,656,347 L800P probably damaging Het
Znhit6 A G 3: 145,600,493 D251G probably benign Het
Other mutations in Ears2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00514:Ears2 APN 7 122039762 nonsense probably null
IGL00870:Ears2 APN 7 122055676 missense probably damaging 1.00
IGL01434:Ears2 APN 7 122063088 splice site probably benign
IGL01676:Ears2 APN 7 122044558 missense probably benign
IGL02341:Ears2 APN 7 122039764 missense probably benign
IGL02355:Ears2 APN 7 122044550 missense probably benign 0.00
IGL02362:Ears2 APN 7 122044550 missense probably benign 0.00
IGL02932:Ears2 APN 7 122063061 missense probably damaging 1.00
PIT4453001:Ears2 UTSW 7 122048339 missense probably benign 0.04
R0555:Ears2 UTSW 7 122048444 missense probably benign 0.22
R0582:Ears2 UTSW 7 122055658 missense probably benign 0.05
R0588:Ears2 UTSW 7 122044291 splice site probably benign
R0733:Ears2 UTSW 7 122048129 missense possibly damaging 0.83
R1316:Ears2 UTSW 7 122046682 missense probably benign 0.00
R1916:Ears2 UTSW 7 122044578 missense probably benign 0.01
R2862:Ears2 UTSW 7 122062940 missense probably damaging 1.00
R4634:Ears2 UTSW 7 122044609 missense probably benign 0.00
R4686:Ears2 UTSW 7 122048204 missense probably damaging 1.00
R5177:Ears2 UTSW 7 122044460 intron probably benign
R5275:Ears2 UTSW 7 122048198 missense probably damaging 1.00
R5385:Ears2 UTSW 7 122044377 missense probably benign 0.36
R5386:Ears2 UTSW 7 122044377 missense probably benign 0.36
R6510:Ears2 UTSW 7 122062994 missense probably damaging 1.00
R6894:Ears2 UTSW 7 122048224 missense probably damaging 1.00
R7828:Ears2 UTSW 7 122048340 missense probably benign
Z1176:Ears2 UTSW 7 122044581 missense probably damaging 0.98
Z1176:Ears2 UTSW 7 122055710 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- AACCTGTCCAAGATCACGTG -3'
(R):5'- AAAAGTGACGGCTTTCCCACC -3'

Sequencing Primer
(F):5'- CCTGTCCAAGATCACGTGATAGGTG -3'
(R):5'- CTACCACCTAGCCTGTGTGGTAG -3'
Posted On2016-07-22