Incidental Mutation 'R5295:Elovl4'
ID 405361
Institutional Source Beutler Lab
Gene Symbol Elovl4
Ensembl Gene ENSMUSG00000032262
Gene Name elongation of very long chain fatty acids (FEN1/Elo2, SUR4/Elo3, yeast)-like 4
Synonyms
MMRRC Submission 042878-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5295 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 83778692-83806277 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 83780661 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Proline to Leucine at position 273 (P273L)
Ref Sequence ENSEMBL: ENSMUSP00000034796 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034796] [ENSMUST00000183614]
AlphaFold Q9EQC4
Predicted Effect possibly damaging
Transcript: ENSMUST00000034796
AA Change: P273L

PolyPhen 2 Score 0.724 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000034796
Gene: ENSMUSG00000032262
AA Change: P273L

DomainStartEndE-ValueType
Pfam:ELO 41 278 1e-69 PFAM
low complexity region 300 311 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183614
SMART Domains Protein: ENSMUSP00000139163
Gene: ENSMUSG00000032262

DomainStartEndE-ValueType
Pfam:ELO 9 181 1.6e-50 PFAM
Meta Mutation Damage Score 0.1451 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a membrane-bound protein which is a member of the ELO family, proteins which participate in the biosynthesis of fatty acids. Consistent with the expression of the encoded protein in photoreceptor cells of the retina, mutations and small deletions in this gene are associated with Stargardt-like macular dystrophy (STGD3) and autosomal dominant Stargardt-like macular dystrophy (ADMD), also referred to as autosomal dominant atrophic macular degeneration. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele die before or around birth. Mice heterozygous for a null allele breed poorly and display mild retinal abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alpk2 C T 18: 65,305,038 E1095K probably damaging Het
Alpl T C 4: 137,749,608 T245A probably benign Het
Ank2 T C 3: 127,032,183 H378R probably damaging Het
Arhgef1 G A 7: 24,919,352 probably null Het
Atp5c1 T C 2: 10,068,733 R10G possibly damaging Het
Cbln3 T C 14: 55,883,463 probably null Het
Ccr10 C T 11: 101,174,285 V140M possibly damaging Het
Cep135 T A 5: 76,593,204 H42Q possibly damaging Het
Commd5 C A 15: 76,900,952 T183K possibly damaging Het
Dnajc16 T C 4: 141,767,928 E493G possibly damaging Het
Ears2 T C 7: 122,048,198 R288G probably damaging Het
Fam186b T A 15: 99,283,874 I148F probably damaging Het
Fryl T C 5: 73,112,791 Y79C probably damaging Het
Gad1-ps A G 10: 99,444,889 noncoding transcript Het
Gm14325 G A 2: 177,832,984 H102Y possibly damaging Het
Gm8882 T G 6: 132,361,877 Q126P unknown Het
Ighv1-77 T A 12: 115,861,908 S104C probably damaging Het
Kcnv1 T C 15: 45,114,591 D17G unknown Het
Lmtk3 G A 7: 45,791,298 D243N probably damaging Het
Lrrc7 T A 3: 158,170,739 K571N probably damaging Het
Lsm7 T C 10: 80,854,620 E32G probably damaging Het
Ly6f A G 15: 75,271,639 Q65R probably benign Het
Perm1 T C 4: 156,217,518 L173P probably benign Het
Plvap T C 8: 71,511,670 Q16R probably benign Het
Prl7d1 A T 13: 27,709,247 V227D probably damaging Het
Prss54 T C 8: 95,564,478 T165A probably damaging Het
Psrc1 A G 3: 108,386,359 I195V probably benign Het
Rnf123 AT ATT 9: 108,064,003 probably null Het
Rnf213 A T 11: 119,440,816 T2284S probably benign Het
Serpina3c T C 12: 104,148,378 E333G probably damaging Het
Serpinb6c A G 13: 33,893,817 F190S probably damaging Het
Sfmbt1 G A 14: 30,774,029 D90N probably damaging Het
Tdh T C 14: 63,496,109 Y110C probably damaging Het
Tdrd9 T A 12: 112,051,912 L1255* probably null Het
Trim41 TTCCTCCTCCTCCTCCTCCTCCTCCTCC TTCCTCCTCCTCCTCCTCCTCCTCC 11: 48,816,257 probably benign Het
Vps51 T G 19: 6,071,033 E283D probably benign Het
Zbtb2 T C 10: 4,368,508 K506R probably damaging Het
Zmiz1 T C 14: 25,656,347 L800P probably damaging Het
Znhit6 A G 3: 145,600,493 D251G probably benign Het
Other mutations in Elovl4
AlleleSourceChrCoordTypePredicted EffectPPH Score
hershey UTSW 9 83806038 start codon destroyed probably null 0.31
R0278:Elovl4 UTSW 9 83783195 missense probably benign 0.00
R0563:Elovl4 UTSW 9 83785034 critical splice donor site probably null
R0739:Elovl4 UTSW 9 83785109 missense probably damaging 1.00
R0771:Elovl4 UTSW 9 83785115 missense possibly damaging 0.95
R1970:Elovl4 UTSW 9 83780719 missense probably damaging 1.00
R2316:Elovl4 UTSW 9 83780773 missense probably damaging 1.00
R3777:Elovl4 UTSW 9 83785148 frame shift probably null
R3779:Elovl4 UTSW 9 83785148 frame shift probably null
R4823:Elovl4 UTSW 9 83780685 missense probably damaging 1.00
R4827:Elovl4 UTSW 9 83806038 start codon destroyed probably null 0.31
R5264:Elovl4 UTSW 9 83780764 missense probably benign 0.19
R5275:Elovl4 UTSW 9 83780661 missense possibly damaging 0.72
R5361:Elovl4 UTSW 9 83790101 missense possibly damaging 0.95
R5364:Elovl4 UTSW 9 83790023 missense probably benign 0.21
R5897:Elovl4 UTSW 9 83790104 missense possibly damaging 0.50
R6433:Elovl4 UTSW 9 83785178 missense possibly damaging 0.46
R6668:Elovl4 UTSW 9 83805986 missense probably benign 0.02
R6844:Elovl4 UTSW 9 83790111 missense probably benign 0.09
R6897:Elovl4 UTSW 9 83783225 missense probably benign 0.05
R6933:Elovl4 UTSW 9 83785100 missense probably damaging 1.00
R7534:Elovl4 UTSW 9 83790119 missense probably damaging 1.00
R7544:Elovl4 UTSW 9 83783218 missense probably damaging 1.00
R7843:Elovl4 UTSW 9 83788271 missense probably damaging 1.00
R8303:Elovl4 UTSW 9 83788267 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GAAGGGCAAAGACCCTATCTG -3'
(R):5'- GCTCTCATGAAATGTTCCCTGC -3'

Sequencing Primer
(F):5'- GCCCCTGAACTTTTTAAAATGACAC -3'
(R):5'- CATGAAATGTTCCCTGCTTCTG -3'
Posted On 2016-07-22