Incidental Mutation 'R5295:Gad1-ps'
ID 405364
Institutional Source Beutler Lab
Gene Symbol Gad1-ps
Ensembl Gene ENSMUSG00000090665
Gene Name glutamate decarboxylase 1, pseudogene
Synonyms Gad-1ps
MMRRC Submission 042878-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.208) question?
Stock # R5295 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 99279906-99281681 bp(+) (GRCm39)
Type of Mutation exon
DNA Base Change (assembly) A to G at 99280751 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s):
AlphaFold no structure available at present
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167243
SMART Domains Protein: ENSMUSP00000133048
Gene: ENSMUSG00000090665

DomainStartEndE-ValueType
Pfam:Pyridoxal_deC 1 368 4.3e-153 PFAM
Pfam:Beta_elim_lyase 91 436 7.3e-8 PFAM
Pfam:Aminotran_5 130 370 4.7e-7 PFAM
Meta Mutation Damage Score 0.5596 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alpk2 C T 18: 65,438,109 (GRCm39) E1095K probably damaging Het
Alpl T C 4: 137,476,919 (GRCm39) T245A probably benign Het
Ank2 T C 3: 126,825,832 (GRCm39) H378R probably damaging Het
Arhgef1 G A 7: 24,618,777 (GRCm39) probably null Het
Atp5f1c T C 2: 10,073,544 (GRCm39) R10G possibly damaging Het
Cbln3 T C 14: 56,120,920 (GRCm39) probably null Het
Ccr10 C T 11: 101,065,111 (GRCm39) V140M possibly damaging Het
Cep135 T A 5: 76,741,051 (GRCm39) H42Q possibly damaging Het
Commd5 C A 15: 76,785,152 (GRCm39) T183K possibly damaging Het
Dnajc16 T C 4: 141,495,239 (GRCm39) E493G possibly damaging Het
Ears2 T C 7: 121,647,421 (GRCm39) R288G probably damaging Het
Elovl4 G A 9: 83,662,714 (GRCm39) P273L possibly damaging Het
Fam186b T A 15: 99,181,755 (GRCm39) I148F probably damaging Het
Fryl T C 5: 73,270,134 (GRCm39) Y79C probably damaging Het
Gm14325 G A 2: 177,474,777 (GRCm39) H102Y possibly damaging Het
Ighv1-77 T A 12: 115,825,528 (GRCm39) S104C probably damaging Het
Kcnv1 T C 15: 44,977,987 (GRCm39) D17G unknown Het
Lmtk3 G A 7: 45,440,722 (GRCm39) D243N probably damaging Het
Lrrc7 T A 3: 157,876,376 (GRCm39) K571N probably damaging Het
Lsm7 T C 10: 80,690,454 (GRCm39) E32G probably damaging Het
Ly6f A G 15: 75,143,488 (GRCm39) Q65R probably benign Het
Perm1 T C 4: 156,301,975 (GRCm39) L173P probably benign Het
Plvap T C 8: 71,964,314 (GRCm39) Q16R probably benign Het
Prb1c T G 6: 132,338,840 (GRCm39) Q126P unknown Het
Prl7d1 A T 13: 27,893,230 (GRCm39) V227D probably damaging Het
Prss54 T C 8: 96,291,106 (GRCm39) T165A probably damaging Het
Psrc1 A G 3: 108,293,675 (GRCm39) I195V probably benign Het
Rnf123 AT ATT 9: 107,941,202 (GRCm39) probably null Het
Rnf213 A T 11: 119,331,642 (GRCm39) T2284S probably benign Het
Serpina3c T C 12: 104,114,637 (GRCm39) E333G probably damaging Het
Serpinb6c A G 13: 34,077,800 (GRCm39) F190S probably damaging Het
Sfmbt1 G A 14: 30,495,986 (GRCm39) D90N probably damaging Het
Tdh T C 14: 63,733,558 (GRCm39) Y110C probably damaging Het
Tdrd9 T A 12: 112,018,346 (GRCm39) L1255* probably null Het
Trim41 TTCCTCCTCCTCCTCCTCCTCCTCCTCC TTCCTCCTCCTCCTCCTCCTCCTCC 11: 48,707,084 (GRCm39) probably benign Het
Vps51 T G 19: 6,121,063 (GRCm39) E283D probably benign Het
Zbtb2 T C 10: 4,318,508 (GRCm39) K506R probably damaging Het
Zmiz1 T C 14: 25,656,771 (GRCm39) L800P probably damaging Het
Znhit6 A G 3: 145,306,248 (GRCm39) D251G probably benign Het
Other mutations in Gad1-ps
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00963:Gad1-ps APN 10 99,281,310 (GRCm39) exon noncoding transcript
IGL01301:Gad1-ps APN 10 99,281,013 (GRCm39) exon noncoding transcript
IGL01394:Gad1-ps APN 10 99,281,424 (GRCm39) exon noncoding transcript
IGL02220:Gad1-ps APN 10 99,281,184 (GRCm39) exon noncoding transcript
IGL02240:Gad1-ps APN 10 99,280,820 (GRCm39) exon noncoding transcript
IGL03406:Gad1-ps APN 10 99,280,641 (GRCm39) exon noncoding transcript
ANU18:Gad1-ps UTSW 10 99,281,013 (GRCm39) exon noncoding transcript
R0305:Gad1-ps UTSW 10 99,280,665 (GRCm39) exon noncoding transcript
R0446:Gad1-ps UTSW 10 99,281,383 (GRCm39) exon noncoding transcript
R0538:Gad1-ps UTSW 10 99,280,854 (GRCm39) exon noncoding transcript
R1511:Gad1-ps UTSW 10 99,281,331 (GRCm39) exon noncoding transcript
R1734:Gad1-ps UTSW 10 99,281,637 (GRCm39) exon noncoding transcript
R1745:Gad1-ps UTSW 10 99,281,386 (GRCm39) exon noncoding transcript
R1886:Gad1-ps UTSW 10 99,281,444 (GRCm39) exon noncoding transcript
R3111:Gad1-ps UTSW 10 99,280,383 (GRCm39) exon noncoding transcript
R3617:Gad1-ps UTSW 10 99,281,260 (GRCm39) exon noncoding transcript
R5042:Gad1-ps UTSW 10 99,281,516 (GRCm39) exon noncoding transcript
R5223:Gad1-ps UTSW 10 99,281,009 (GRCm39) exon noncoding transcript
R5234:Gad1-ps UTSW 10 99,281,188 (GRCm39) exon noncoding transcript
R5275:Gad1-ps UTSW 10 99,280,751 (GRCm39) exon noncoding transcript
R5334:Gad1-ps UTSW 10 99,281,009 (GRCm39) exon noncoding transcript
R5335:Gad1-ps UTSW 10 99,281,009 (GRCm39) exon noncoding transcript
R5336:Gad1-ps UTSW 10 99,281,009 (GRCm39) exon noncoding transcript
R5337:Gad1-ps UTSW 10 99,281,009 (GRCm39) exon noncoding transcript
R5396:Gad1-ps UTSW 10 99,281,009 (GRCm39) exon noncoding transcript
R5397:Gad1-ps UTSW 10 99,281,009 (GRCm39) exon noncoding transcript
R5399:Gad1-ps UTSW 10 99,281,009 (GRCm39) exon noncoding transcript
R5428:Gad1-ps UTSW 10 99,281,009 (GRCm39) exon noncoding transcript
R5429:Gad1-ps UTSW 10 99,281,009 (GRCm39) exon noncoding transcript
R5431:Gad1-ps UTSW 10 99,281,009 (GRCm39) exon noncoding transcript
R5661:Gad1-ps UTSW 10 99,280,901 (GRCm39) exon noncoding transcript
R5667:Gad1-ps UTSW 10 99,280,395 (GRCm39) exon noncoding transcript
R5671:Gad1-ps UTSW 10 99,280,395 (GRCm39) exon noncoding transcript
R5885:Gad1-ps UTSW 10 99,281,009 (GRCm39) exon noncoding transcript
R5886:Gad1-ps UTSW 10 99,281,009 (GRCm39) exon noncoding transcript
Predicted Primers PCR Primer
(F):5'- ACCCGTGTTTGTTCTCATGG -3'
(R):5'- TCAAAAGCTCCGTAAACAGTCG -3'

Sequencing Primer
(F):5'- TGGAACAGATCACACTTAAGAAGATG -3'
(R):5'- TCCGTAAACAGTCGTGCCTG -3'
Posted On 2016-07-22