Mutagenetix > Incidental Mutation

Incidental Mutation 'R5295:Ccr10'

405366

Institutional Source

Beutler Lab

Gene Symbol

Ccr10

Ensembl Gene

ENSMUSG00000044052

Gene Name

chemokine (C-C motif) receptor 10

Synonyms

Cmkbr9, GPR2, CCR10

MMRRC Submission

042878-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5295 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

101172997-101175443 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 101174285 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Methionine at position 140 (V140M)

Ref Sequence

ENSEMBL: ENSMUSP00000062588 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043397] [ENSMUST00000062759] [ENSMUST00000103109] [ENSMUST00000123864] [ENSMUST00000129895] [ENSMUST00000164474]

AlphaFold

Q9JL21

Predicted Effect

probably benign
Transcript: ENSMUST00000043397

SMART Domains

Protein: ENSMUSP00000046044
Gene: ENSMUSG00000035172

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
low complexity region	23	40	N/A	INTRINSIC
PH	96	201	1.9e-5	SMART
low complexity region	241	251	N/A	INTRINSIC
Pfam:MyTH4	285	398	4.2e-21	PFAM
B41	400	664	2.91e-4	SMART
low complexity region	750	766	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000062759
AA Change: V140M

PolyPhen 2 Score 0.923 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000062588
Gene: ENSMUSG00000044052
AA Change: V140M

Domain	Start	End	E-Value	Type
Pfam:7tm_1	58	310	4.8e-43	PFAM
low complexity region	313	329	N/A	INTRINSIC
low complexity region	336	349	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000103109

SMART Domains

Protein: ENSMUSP00000099398
Gene: ENSMUSG00000017167

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
FA58C	25	169	7.49e-36	SMART
LamG	196	333	2.86e-32	SMART
LamG	382	516	3.49e-27	SMART
EGF	544	578	2.28e0	SMART
Blast:FBG	580	777	1e-133	BLAST
LamG	806	940	1.95e-25	SMART
EGF_like	961	997	6.03e1	SMART
low complexity region	1032	1044	N/A	INTRINSIC
low complexity region	1047	1058	N/A	INTRINSIC
low complexity region	1063	1078	N/A	INTRINSIC
LamG	1081	1219	2.59e-30	SMART
4.1m	1305	1323	7.85e-7	SMART
low complexity region	1333	1370	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000123864

SMART Domains

Protein: ENSMUSP00000120865
Gene: ENSMUSG00000035172

Domain	Start	End	E-Value	Type
PH	95	200	1.9e-5	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000129895

SMART Domains

Protein: ENSMUSP00000137841
Gene: ENSMUSG00000035172

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
low complexity region	23	40	N/A	INTRINSIC
PH	96	201	1.9e-5	SMART
low complexity region	241	251	N/A	INTRINSIC
Pfam:MyTH4	281	399	2.7e-16	PFAM
B41	400	664	5.17e-4	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000138942

Predicted Effect

probably benign
Transcript: ENSMUST00000164474

SMART Domains

Protein: ENSMUSP00000127088
Gene: ENSMUSG00000035172

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
low complexity region	23	40	N/A	INTRINSIC
PH	96	201	1.9e-5	SMART
low complexity region	241	251	N/A	INTRINSIC
Pfam:MyTH4	281	399	3.3e-16	PFAM
B41	400	661	6.14e-4	SMART
low complexity region	747	763	N/A	INTRINSIC

Meta Mutation Damage Score

0.1522

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Chemokines are a group of small (approximately 8 to 14 kD), mostly basic, structurally related molecules that regulate cell trafficking of various types of leukocytes through interactions with a subset of 7-transmembrane, G protein-coupled receptors. Chemokines also play fundamental roles in the development, homeostasis, and function of the immune system, and they have effects on cells of the central nervous system as well as on endothelial cells involved in angiogenesis or angiostasis. Chemokines are divided into 2 major subfamilies, CXC and CC, based on the arrangement of the first 2 of the 4 conserved cysteine residues; the 2 cysteines are separated by a single amino acid in CXC chemokines and are adjacent in CC chemokines. CCR10 is the receptor for CCL27 (SCYA27; MIM 604833); CCR10-CCL27 interactions are involved in T cell-mediated skin inflammation (Homey et al., 2002 [PubMed 11821900]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for null mutation are viable and fertile, without any detectable neurological abnormalities. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 39 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Alpk2	C	T	18: 65,305,038	E1095K	probably damaging	Het
Alpl	T	C	4: 137,749,608	T245A	probably benign	Het
Ank2	T	C	3: 127,032,183	H378R	probably damaging	Het
Arhgef1	G	A	7: 24,919,352		probably null	Het
Atp5c1	T	C	2: 10,068,733	R10G	possibly damaging	Het
Cbln3	T	C	14: 55,883,463		probably null	Het
Cep135	T	A	5: 76,593,204	H42Q	possibly damaging	Het
Commd5	C	A	15: 76,900,952	T183K	possibly damaging	Het
Dnajc16	T	C	4: 141,767,928	E493G	possibly damaging	Het
Ears2	T	C	7: 122,048,198	R288G	probably damaging	Het
Elovl4	G	A	9: 83,780,661	P273L	possibly damaging	Het
Fam186b	T	A	15: 99,283,874	I148F	probably damaging	Het
Fryl	T	C	5: 73,112,791	Y79C	probably damaging	Het
Gad1-ps	A	G	10: 99,444,889		noncoding transcript	Het
Gm14325	G	A	2: 177,832,984	H102Y	possibly damaging	Het
Gm8882	T	G	6: 132,361,877	Q126P	unknown	Het
Ighv1-77	T	A	12: 115,861,908	S104C	probably damaging	Het
Kcnv1	T	C	15: 45,114,591	D17G	unknown	Het
Lmtk3	G	A	7: 45,791,298	D243N	probably damaging	Het
Lrrc7	T	A	3: 158,170,739	K571N	probably damaging	Het
Lsm7	T	C	10: 80,854,620	E32G	probably damaging	Het
Ly6f	A	G	15: 75,271,639	Q65R	probably benign	Het
Perm1	T	C	4: 156,217,518	L173P	probably benign	Het
Plvap	T	C	8: 71,511,670	Q16R	probably benign	Het
Prl7d1	A	T	13: 27,709,247	V227D	probably damaging	Het
Prss54	T	C	8: 95,564,478	T165A	probably damaging	Het
Psrc1	A	G	3: 108,386,359	I195V	probably benign	Het
Rnf123	AT	ATT	9: 108,064,003		probably null	Het
Rnf213	A	T	11: 119,440,816	T2284S	probably benign	Het
Serpina3c	T	C	12: 104,148,378	E333G	probably damaging	Het
Serpinb6c	A	G	13: 33,893,817	F190S	probably damaging	Het
Sfmbt1	G	A	14: 30,774,029	D90N	probably damaging	Het
Tdh	T	C	14: 63,496,109	Y110C	probably damaging	Het
Tdrd9	T	A	12: 112,051,912	L1255*	probably null	Het
Trim41	TTCCTCCTCCTCCTCCTCCTCCTCCTCC	TTCCTCCTCCTCCTCCTCCTCCTCC	11: 48,816,257		probably benign	Het
Vps51	T	G	19: 6,071,033	E283D	probably benign	Het
Zbtb2	T	C	10: 4,368,508	K506R	probably damaging	Het
Zmiz1	T	C	14: 25,656,347	L800P	probably damaging	Het
Znhit6	A	G	3: 145,600,493	D251G	probably benign	Het

Other mutations in Ccr10

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02887:Ccr10	APN	11	101174666	missense	probably benign	0.01
R1523:Ccr10	UTSW	11	101173675	missense	probably damaging	0.98
R1696:Ccr10	UTSW	11	101174384	missense	probably benign	0.25
R5275:Ccr10	UTSW	11	101174285	missense	possibly damaging	0.92
R5418:Ccr10	UTSW	11	101174078	missense	probably benign	0.16
R6219:Ccr10	UTSW	11	101174549	missense	possibly damaging	0.85
R7161:Ccr10	UTSW	11	101174278	missense	probably benign	0.02
R7674:Ccr10	UTSW	11	101174649	missense	probably benign
R8458:Ccr10	UTSW	11	101174156	missense	probably damaging	1.00
R9596:Ccr10	UTSW	11	101174192	missense	probably benign
Z1176:Ccr10	UTSW	11	101174323	missense	probably damaging	1.00
Z1176:Ccr10	UTSW	11	101174340	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- TTTCACAGTCTGCGTGAGG -3'
(R):5'- TAGTCTTGGCCACCCATCTG -3'

Sequencing Primer
(F):5'- CACAGTCTGCGTGAGGCTTTC -3'
(R):5'- TGGCAGCCAGACGAACTAC -3'

Posted On

2016-07-22