Incidental Mutation 'R0497:Mlkl'
ID 40537
Institutional Source Beutler Lab
Gene Symbol Mlkl
Ensembl Gene ENSMUSG00000012519
Gene Name mixed lineage kinase domain-like
Synonyms 9130019I15Rik
MMRRC Submission 038693-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock # R0497 (G1)
Quality Score 225
Status Validated
Chromosome 8
Chromosomal Location 111311797-111338177 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 111327873 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 211 (Y211H)
Ref Sequence ENSEMBL: ENSMUSP00000113718 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056157] [ENSMUST00000120432] [ENSMUST00000145862]
AlphaFold Q9D2Y4
Predicted Effect probably damaging
Transcript: ENSMUST00000056157
AA Change: Y211H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000055521
Gene: ENSMUSG00000012519
AA Change: Y211H

low complexity region 109 115 N/A INTRINSIC
Pfam:Pkinase_Tyr 195 448 2.7e-41 PFAM
Pfam:Pkinase 200 450 2.1e-30 PFAM
Pfam:Kinase-like 270 438 1.6e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000120432
AA Change: Y211H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113718
Gene: ENSMUSG00000012519
AA Change: Y211H

low complexity region 109 115 N/A INTRINSIC
Pfam:Pkinase_Tyr 195 453 3.3e-42 PFAM
Pfam:Pkinase 196 453 1.4e-33 PFAM
Pfam:Kinase-like 270 438 8.9e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145862
SMART Domains Protein: ENSMUSP00000114701
Gene: ENSMUSG00000012519

PDB:4BTF|A 9 176 1e-114 PDB
Meta Mutation Damage Score 0.8743 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.7%
  • 10x: 96.6%
  • 20x: 93.1%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: This gene belongs to the protein kinase superfamily. The encoded protein contains a protein kinase-like domain; however, is thought to lack protein kinase activity. This protein plays a critical role in tumor necrosis factor (TNF)-induced necroptosis, a programmed cell death process, via interaction with receptor-interacting protein 3 (Rip3), which is a key signaling molecule in necroptosis pathway. Knockout of this gene in mice showed that it is essential for necroptosis. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit imapired macrophage and mouse embryonic fibroblast necroptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik T A 7: 28,147,465 C1158S probably damaging Het
Aatk A C 11: 120,018,780 V110G probably damaging Het
Adcy6 A C 15: 98,597,725 probably null Het
Adm A G 7: 110,629,121 T170A probably benign Het
Afap1l2 G T 19: 56,930,209 N171K probably benign Het
Aph1b G T 9: 66,790,618 S112* probably null Het
Arhgap23 A G 11: 97,452,163 S424G probably damaging Het
Asah2 T A 19: 32,054,631 N46I probably benign Het
Braf G A 6: 39,640,549 probably benign Het
Brd2 C T 17: 34,114,360 R47Q probably damaging Het
C2cd5 A G 6: 143,012,093 V972A probably benign Het
Car9 T A 4: 43,511,881 L300H probably damaging Het
Chmp3 T C 6: 71,552,411 S20P probably damaging Het
Chp1 A G 2: 119,571,782 N79S possibly damaging Het
Cnot2 A T 10: 116,498,355 I335N probably damaging Het
Cntnap4 T C 8: 112,570,151 V6A probably benign Het
Ctcf T A 8: 105,675,040 probably benign Het
Dennd1b A G 1: 139,039,986 probably benign Het
Dirc2 A T 16: 35,735,604 V162D probably benign Het
Dnmbp A G 19: 43,856,640 probably benign Het
Eef2 T C 10: 81,181,586 F782L probably benign Het
Eogt T A 6: 97,135,233 Y153F probably benign Het
Fam81a G T 9: 70,096,119 Q237K possibly damaging Het
Fat2 T A 11: 55,283,402 T2162S probably benign Het
Gas6 T C 8: 13,470,387 I434V possibly damaging Het
Gm42417 A T 1: 36,532,167 L77Q probably damaging Het
Grik3 A T 4: 125,623,510 N49Y possibly damaging Het
Gucy2e A T 11: 69,224,159 V974E probably damaging Het
Helz2 A G 2: 181,229,656 V2721A probably damaging Het
Klhl6 GT G 16: 19,956,966 279 probably null Het
Krt73 A G 15: 101,802,230 L23P probably damaging Het
L3mbtl3 T C 10: 26,282,874 probably benign Het
Lrrc15 A T 16: 30,272,892 V543E probably damaging Het
Med13 G A 11: 86,276,983 probably benign Het
Med25 T C 7: 44,892,100 D60G probably damaging Het
Mgam T A 6: 40,664,892 Y560N probably damaging Het
Msl2 A G 9: 101,101,294 N289S probably benign Het
Nwd2 G T 5: 63,806,343 W1090L probably damaging Het
Olfr1281 A G 2: 111,328,830 D137G probably benign Het
Omt2b T C 9: 78,328,231 probably benign Het
Pald1 A G 10: 61,341,315 L652P probably damaging Het
Pard3b T A 1: 62,440,008 probably null Het
Prdm15 G A 16: 97,794,334 T1098I possibly damaging Het
Rock2 A G 12: 16,954,953 T436A probably benign Het
Sema4c A T 1: 36,549,608 D812E probably benign Het
Sla A T 15: 66,792,249 I91K probably benign Het
Slc22a16 T G 10: 40,584,967 M255R probably damaging Het
Smg8 C T 11: 87,086,084 D224N possibly damaging Het
Spdef A T 17: 27,718,058 D190E probably benign Het
Taok1 A G 11: 77,573,804 I152T probably damaging Het
Tmem220 A G 11: 67,025,922 D36G probably damaging Het
Tmem235 A C 11: 117,864,351 I210L probably benign Het
Tmem266 C T 9: 55,380,884 probably null Het
Tmprss12 A G 15: 100,281,039 probably benign Het
Trim32 G A 4: 65,613,254 R16Q probably damaging Het
Usp38 T A 8: 80,984,424 probably benign Het
Usp44 C T 10: 93,846,806 P373S possibly damaging Het
Vmn1r209 G T 13: 22,805,948 Q191K probably damaging Het
Vmn1r70 T C 7: 10,634,026 I147T probably benign Het
Vmn2r107 T A 17: 20,375,132 I649N probably damaging Het
Vmn2r12 A T 5: 109,091,889 Y269* probably null Het
Zan C T 5: 137,412,676 probably benign Het
Zfp616 G T 11: 74,083,480 V192L probably benign Het
Zfp644 A T 5: 106,638,333 V116D probably damaging Het
Zgrf1 T C 3: 127,584,650 probably benign Het
Zhx3 A T 2: 160,779,994 L751* probably null Het
Znfx1 T A 2: 167,055,411 Q531L probably benign Het
Other mutations in Mlkl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Mlkl APN 8 111319428 nonsense probably null
IGL01376:Mlkl APN 8 111319747 missense probably damaging 1.00
IGL02801:Mlkl APN 8 111316432 missense probably benign 0.18
IGL02965:Mlkl APN 8 111331837 missense probably benign 0.31
IGL03121:Mlkl APN 8 111314980 missense probably damaging 1.00
Ghoulish UTSW 8 111322748 missense probably damaging 1.00
mecro UTSW 8 111319716 critical splice donor site probably null
necro UTSW 8 111312100 intron probably benign
secro UTSW 8 111315567 intron probably benign
R0133:Mlkl UTSW 8 111327948 missense probably damaging 1.00
R0230:Mlkl UTSW 8 111315062 missense probably benign 0.07
R0387:Mlkl UTSW 8 111333350 missense probably damaging 1.00
R0735:Mlkl UTSW 8 111327801 unclassified probably benign
R1733:Mlkl UTSW 8 111322748 missense probably damaging 1.00
R1761:Mlkl UTSW 8 111333723 missense possibly damaging 0.81
R1911:Mlkl UTSW 8 111312100 intron probably benign
R2057:Mlkl UTSW 8 111333610 missense probably benign 0.07
R2921:Mlkl UTSW 8 111316447 missense probably benign 0.02
R3745:Mlkl UTSW 8 111315567 intron probably benign
R4760:Mlkl UTSW 8 111319716 critical splice donor site probably null
R5377:Mlkl UTSW 8 111327937 missense probably benign 0.23
R7052:Mlkl UTSW 8 111319442 missense possibly damaging 0.65
R7155:Mlkl UTSW 8 111319403 missense probably damaging 1.00
R7459:Mlkl UTSW 8 111333530 missense probably benign 0.36
R7728:Mlkl UTSW 8 111333619 missense probably damaging 1.00
R8036:Mlkl UTSW 8 111333454 missense probably damaging 1.00
R8064:Mlkl UTSW 8 111312068 missense probably benign 0.38
R9088:Mlkl UTSW 8 111322733 missense
R9152:Mlkl UTSW 8 111319771 missense probably damaging 1.00
R9275:Mlkl UTSW 8 111316423 missense probably benign 0.07
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- gtgaacttgatgcttgtgcc -3'
Posted On 2013-05-23