Incidental Mutation 'R0497:Mlkl'
ID 40537
Institutional Source Beutler Lab
Gene Symbol Mlkl
Ensembl Gene ENSMUSG00000012519
Gene Name mixed lineage kinase domain-like
Synonyms 9130019I15Rik
MMRRC Submission 038693-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.087) question?
Stock # R0497 (G1)
Quality Score 225
Status Validated
Chromosome 8
Chromosomal Location 112038429-112064809 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 112054505 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 211 (Y211H)
Ref Sequence ENSEMBL: ENSMUSP00000113718 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056157] [ENSMUST00000120432] [ENSMUST00000145862]
AlphaFold Q9D2Y4
Predicted Effect probably damaging
Transcript: ENSMUST00000056157
AA Change: Y211H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000055521
Gene: ENSMUSG00000012519
AA Change: Y211H

DomainStartEndE-ValueType
low complexity region 109 115 N/A INTRINSIC
Pfam:Pkinase_Tyr 195 448 2.7e-41 PFAM
Pfam:Pkinase 200 450 2.1e-30 PFAM
Pfam:Kinase-like 270 438 1.6e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000120432
AA Change: Y211H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113718
Gene: ENSMUSG00000012519
AA Change: Y211H

DomainStartEndE-ValueType
low complexity region 109 115 N/A INTRINSIC
Pfam:Pkinase_Tyr 195 453 3.3e-42 PFAM
Pfam:Pkinase 196 453 1.4e-33 PFAM
Pfam:Kinase-like 270 438 8.9e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145862
SMART Domains Protein: ENSMUSP00000114701
Gene: ENSMUSG00000012519

DomainStartEndE-ValueType
PDB:4BTF|A 9 176 1e-114 PDB
Meta Mutation Damage Score 0.8743 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.7%
  • 10x: 96.6%
  • 20x: 93.1%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: This gene belongs to the protein kinase superfamily. The encoded protein contains a protein kinase-like domain; however, is thought to lack protein kinase activity. This protein plays a critical role in tumor necrosis factor (TNF)-induced necroptosis, a programmed cell death process, via interaction with receptor-interacting protein 3 (Rip3), which is a key signaling molecule in necroptosis pathway. Knockout of this gene in mice showed that it is essential for necroptosis. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit imapired macrophage and mouse embryonic fibroblast necroptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk A C 11: 119,909,606 (GRCm39) V110G probably damaging Het
Adcy6 A C 15: 98,495,606 (GRCm39) probably null Het
Adm A G 7: 110,228,328 (GRCm39) T170A probably benign Het
Afap1l2 G T 19: 56,918,641 (GRCm39) N171K probably benign Het
Aph1b G T 9: 66,697,900 (GRCm39) S112* probably null Het
Arhgap23 A G 11: 97,342,989 (GRCm39) S424G probably damaging Het
Asah2 T A 19: 32,032,031 (GRCm39) N46I probably benign Het
Braf G A 6: 39,617,483 (GRCm39) probably benign Het
Brd2 C T 17: 34,333,334 (GRCm39) R47Q probably damaging Het
C2cd5 A G 6: 142,957,819 (GRCm39) V972A probably benign Het
Car9 T A 4: 43,511,881 (GRCm39) L300H probably damaging Het
Chmp3 T C 6: 71,529,395 (GRCm39) S20P probably damaging Het
Chp1 A G 2: 119,402,263 (GRCm39) N79S possibly damaging Het
Cnot2 A T 10: 116,334,260 (GRCm39) I335N probably damaging Het
Cntnap4 T C 8: 113,296,783 (GRCm39) V6A probably benign Het
Ctcf T A 8: 106,401,672 (GRCm39) probably benign Het
Dennd1b A G 1: 138,967,724 (GRCm39) probably benign Het
Dnmbp A G 19: 43,845,079 (GRCm39) probably benign Het
Eef2 T C 10: 81,017,420 (GRCm39) F782L probably benign Het
Eogt T A 6: 97,112,194 (GRCm39) Y153F probably benign Het
Fam81a G T 9: 70,003,401 (GRCm39) Q237K possibly damaging Het
Fat2 T A 11: 55,174,228 (GRCm39) T2162S probably benign Het
Fcgbpl1 T A 7: 27,846,890 (GRCm39) C1158S probably damaging Het
Gas6 T C 8: 13,520,387 (GRCm39) I434V possibly damaging Het
Gm42417 A T 1: 36,571,248 (GRCm39) L77Q probably damaging Het
Grik3 A T 4: 125,517,303 (GRCm39) N49Y possibly damaging Het
Gucy2e A T 11: 69,114,985 (GRCm39) V974E probably damaging Het
Helz2 A G 2: 180,871,449 (GRCm39) V2721A probably damaging Het
Klhl6 GT G 16: 19,775,716 (GRCm39) 279 probably null Het
Krt73 A G 15: 101,710,665 (GRCm39) L23P probably damaging Het
L3mbtl3 T C 10: 26,158,772 (GRCm39) probably benign Het
Lrrc15 A T 16: 30,091,710 (GRCm39) V543E probably damaging Het
Med13 G A 11: 86,167,809 (GRCm39) probably benign Het
Med25 T C 7: 44,541,524 (GRCm39) D60G probably damaging Het
Mgam T A 6: 40,641,826 (GRCm39) Y560N probably damaging Het
Msl2 A G 9: 100,978,493 (GRCm39) N289S probably benign Het
Nwd2 G T 5: 63,963,686 (GRCm39) W1090L probably damaging Het
Omt2b T C 9: 78,235,513 (GRCm39) probably benign Het
Or4k37 A G 2: 111,159,175 (GRCm39) D137G probably benign Het
Pald1 A G 10: 61,177,094 (GRCm39) L652P probably damaging Het
Pard3b T A 1: 62,479,167 (GRCm39) probably null Het
Prdm15 G A 16: 97,595,534 (GRCm39) T1098I possibly damaging Het
Rock2 A G 12: 17,004,954 (GRCm39) T436A probably benign Het
Sema4c A T 1: 36,588,689 (GRCm39) D812E probably benign Het
Sla A T 15: 66,664,098 (GRCm39) I91K probably benign Het
Slc22a16 T G 10: 40,460,963 (GRCm39) M255R probably damaging Het
Slc49a4 A T 16: 35,555,974 (GRCm39) V162D probably benign Het
Smg8 C T 11: 86,976,910 (GRCm39) D224N possibly damaging Het
Spdef A T 17: 27,937,032 (GRCm39) D190E probably benign Het
Taok1 A G 11: 77,464,630 (GRCm39) I152T probably damaging Het
Tmem220 A G 11: 66,916,748 (GRCm39) D36G probably damaging Het
Tmem235 A C 11: 117,755,177 (GRCm39) I210L probably benign Het
Tmem266 C T 9: 55,288,168 (GRCm39) probably null Het
Tmprss12 A G 15: 100,178,920 (GRCm39) probably benign Het
Trim32 G A 4: 65,531,491 (GRCm39) R16Q probably damaging Het
Usp38 T A 8: 81,711,053 (GRCm39) probably benign Het
Usp44 C T 10: 93,682,668 (GRCm39) P373S possibly damaging Het
Vmn1r209 G T 13: 22,990,118 (GRCm39) Q191K probably damaging Het
Vmn1r70 T C 7: 10,367,953 (GRCm39) I147T probably benign Het
Vmn2r107 T A 17: 20,595,394 (GRCm39) I649N probably damaging Het
Vmn2r12 A T 5: 109,239,755 (GRCm39) Y269* probably null Het
Zan C T 5: 137,410,938 (GRCm39) probably benign Het
Zfp616 G T 11: 73,974,306 (GRCm39) V192L probably benign Het
Zfp644 A T 5: 106,786,199 (GRCm39) V116D probably damaging Het
Zgrf1 T C 3: 127,378,299 (GRCm39) probably benign Het
Zhx3 A T 2: 160,621,914 (GRCm39) L751* probably null Het
Znfx1 T A 2: 166,897,331 (GRCm39) Q531L probably benign Het
Other mutations in Mlkl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Mlkl APN 8 112,046,060 (GRCm39) nonsense probably null
IGL01376:Mlkl APN 8 112,046,379 (GRCm39) missense probably damaging 1.00
IGL02801:Mlkl APN 8 112,043,064 (GRCm39) missense probably benign 0.18
IGL02965:Mlkl APN 8 112,058,469 (GRCm39) missense probably benign 0.31
IGL03121:Mlkl APN 8 112,041,612 (GRCm39) missense probably damaging 1.00
Ghoulish UTSW 8 112,049,380 (GRCm39) missense probably damaging 1.00
mecro UTSW 8 112,046,348 (GRCm39) critical splice donor site probably null
necro UTSW 8 112,038,732 (GRCm39) intron probably benign
secro UTSW 8 112,042,199 (GRCm39) intron probably benign
R0133:Mlkl UTSW 8 112,054,580 (GRCm39) missense probably damaging 1.00
R0230:Mlkl UTSW 8 112,041,694 (GRCm39) missense probably benign 0.07
R0387:Mlkl UTSW 8 112,059,982 (GRCm39) missense probably damaging 1.00
R0735:Mlkl UTSW 8 112,054,433 (GRCm39) unclassified probably benign
R1733:Mlkl UTSW 8 112,049,380 (GRCm39) missense probably damaging 1.00
R1761:Mlkl UTSW 8 112,060,355 (GRCm39) missense possibly damaging 0.81
R1911:Mlkl UTSW 8 112,038,732 (GRCm39) intron probably benign
R2057:Mlkl UTSW 8 112,060,242 (GRCm39) missense probably benign 0.07
R2921:Mlkl UTSW 8 112,043,079 (GRCm39) missense probably benign 0.02
R3745:Mlkl UTSW 8 112,042,199 (GRCm39) intron probably benign
R4760:Mlkl UTSW 8 112,046,348 (GRCm39) critical splice donor site probably null
R5377:Mlkl UTSW 8 112,054,569 (GRCm39) missense probably benign 0.23
R7052:Mlkl UTSW 8 112,046,074 (GRCm39) missense possibly damaging 0.65
R7155:Mlkl UTSW 8 112,046,035 (GRCm39) missense probably damaging 1.00
R7459:Mlkl UTSW 8 112,060,162 (GRCm39) missense probably benign 0.36
R7728:Mlkl UTSW 8 112,060,251 (GRCm39) missense probably damaging 1.00
R8036:Mlkl UTSW 8 112,060,086 (GRCm39) missense probably damaging 1.00
R8064:Mlkl UTSW 8 112,038,700 (GRCm39) missense probably benign 0.38
R9088:Mlkl UTSW 8 112,049,365 (GRCm39) missense
R9152:Mlkl UTSW 8 112,046,403 (GRCm39) missense probably damaging 1.00
R9275:Mlkl UTSW 8 112,043,055 (GRCm39) missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- AGAGTTGCCCAAGACTGGCCTA -3'
(R):5'- ACCTTCTGCCCTGAGAAGCTGT -3'

Sequencing Primer
(F):5'- gtgaacttgatgcttgtgcc -3'
(R):5'- TCATGGAGTGGCACTTCCC -3'
Posted On 2013-05-23