Mutagenetix > Incidental Mutation

Incidental Mutation 'R5295:Zmiz1'

405373

Institutional Source

Beutler Lab

Gene Symbol

Zmiz1

Ensembl Gene

ENSMUSG00000007817

Gene Name

zinc finger, MIZ-type containing 1

Synonyms

Rai17, Zimp10

MMRRC Submission

042878-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5295 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

25459185-25666743 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 25656347 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 800 (L800P)

Ref Sequence

ENSEMBL: ENSMUSP00000124863 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000007961] [ENSMUST00000162645]

AlphaFold

Q6P1E1

Predicted Effect

probably damaging
Transcript: ENSMUST00000007961
AA Change: L794P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000007961
Gene: ENSMUSG00000007817
AA Change: L794P

Domain	Start	End	E-Value	Type
low complexity region	123	142	N/A	INTRINSIC
low complexity region	183	201	N/A	INTRINSIC
low complexity region	239	268	N/A	INTRINSIC
SCOP:d1gkub1	280	323	1e-3	SMART
low complexity region	431	446	N/A	INTRINSIC
low complexity region	483	495	N/A	INTRINSIC
low complexity region	498	505	N/A	INTRINSIC
low complexity region	511	526	N/A	INTRINSIC
Pfam:zf-Nse	731	786	3.5e-8	PFAM
Pfam:zf-MIZ	739	788	7.6e-26	PFAM
low complexity region	867	881	N/A	INTRINSIC
low complexity region	982	997	N/A	INTRINSIC
low complexity region	1039	1062	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000162546

Predicted Effect

probably damaging
Transcript: ENSMUST00000162645
AA Change: L800P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000124863
Gene: ENSMUSG00000007817
AA Change: L800P

Domain	Start	End	E-Value	Type
low complexity region	123	142	N/A	INTRINSIC
low complexity region	183	201	N/A	INTRINSIC
low complexity region	239	268	N/A	INTRINSIC
SCOP:d1gkub1	280	309	2e-3	SMART
low complexity region	437	452	N/A	INTRINSIC
low complexity region	489	501	N/A	INTRINSIC
low complexity region	504	511	N/A	INTRINSIC
low complexity region	517	532	N/A	INTRINSIC
Pfam:zf-MIZ	745	794	2.1e-26	PFAM
low complexity region	873	887	N/A	INTRINSIC
low complexity region	988	1003	N/A	INTRINSIC
low complexity region	1045	1068	N/A	INTRINSIC

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the PIAS (protein inhibitor of activated STAT) family of proteins. The encoded protein regulates the activity of various transcription factors, including the androgen receptor, Smad3/4, and p53. The encoded protein may also play a role in sumoylation. A translocation between this locus on chromosome 10 and the protein tyrosine kinase ABL1 locus on chromosome 9 has been associated with acute lymphoblastic leukemia. [provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for a null mutation display embryonic lethality during organogenesis with failure of yolk sac vascular remodeling and abnormal embryonic vascular development. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 39 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Alpk2	C	T	18: 65,305,038	E1095K	probably damaging	Het
Alpl	T	C	4: 137,749,608	T245A	probably benign	Het
Ank2	T	C	3: 127,032,183	H378R	probably damaging	Het
Arhgef1	G	A	7: 24,919,352		probably null	Het
Atp5c1	T	C	2: 10,068,733	R10G	possibly damaging	Het
Cbln3	T	C	14: 55,883,463		probably null	Het
Ccr10	C	T	11: 101,174,285	V140M	possibly damaging	Het
Cep135	T	A	5: 76,593,204	H42Q	possibly damaging	Het
Commd5	C	A	15: 76,900,952	T183K	possibly damaging	Het
Dnajc16	T	C	4: 141,767,928	E493G	possibly damaging	Het
Ears2	T	C	7: 122,048,198	R288G	probably damaging	Het
Elovl4	G	A	9: 83,780,661	P273L	possibly damaging	Het
Fam186b	T	A	15: 99,283,874	I148F	probably damaging	Het
Fryl	T	C	5: 73,112,791	Y79C	probably damaging	Het
Gad1-ps	A	G	10: 99,444,889		noncoding transcript	Het
Gm14325	G	A	2: 177,832,984	H102Y	possibly damaging	Het
Gm8882	T	G	6: 132,361,877	Q126P	unknown	Het
Ighv1-77	T	A	12: 115,861,908	S104C	probably damaging	Het
Kcnv1	T	C	15: 45,114,591	D17G	unknown	Het
Lmtk3	G	A	7: 45,791,298	D243N	probably damaging	Het
Lrrc7	T	A	3: 158,170,739	K571N	probably damaging	Het
Lsm7	T	C	10: 80,854,620	E32G	probably damaging	Het
Ly6f	A	G	15: 75,271,639	Q65R	probably benign	Het
Perm1	T	C	4: 156,217,518	L173P	probably benign	Het
Plvap	T	C	8: 71,511,670	Q16R	probably benign	Het
Prl7d1	A	T	13: 27,709,247	V227D	probably damaging	Het
Prss54	T	C	8: 95,564,478	T165A	probably damaging	Het
Psrc1	A	G	3: 108,386,359	I195V	probably benign	Het
Rnf123	AT	ATT	9: 108,064,003		probably null	Het
Rnf213	A	T	11: 119,440,816	T2284S	probably benign	Het
Serpina3c	T	C	12: 104,148,378	E333G	probably damaging	Het
Serpinb6c	A	G	13: 33,893,817	F190S	probably damaging	Het
Sfmbt1	G	A	14: 30,774,029	D90N	probably damaging	Het
Tdh	T	C	14: 63,496,109	Y110C	probably damaging	Het
Tdrd9	T	A	12: 112,051,912	L1255*	probably null	Het
Trim41	TTCCTCCTCCTCCTCCTCCTCCTCCTCC	TTCCTCCTCCTCCTCCTCCTCCTCC	11: 48,816,257		probably benign	Het
Vps51	T	G	19: 6,071,033	E283D	probably benign	Het
Zbtb2	T	C	10: 4,368,508	K506R	probably damaging	Het
Znhit6	A	G	3: 145,600,493	D251G	probably benign	Het

Other mutations in Zmiz1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00553:Zmiz1	APN	14	25572070	start codon destroyed	probably null	0.53
IGL01582:Zmiz1	APN	14	25658230	missense	probably benign	0.00
IGL01601:Zmiz1	APN	14	25581644	missense	possibly damaging	0.68
IGL02008:Zmiz1	APN	14	25656879	missense	probably damaging	0.97
IGL02395:Zmiz1	APN	14	25656763	missense	probably damaging	1.00
IGL02836:Zmiz1	APN	14	25656742	splice site	probably benign
zapp	UTSW	14	25662980	missense	unknown
R0144:Zmiz1	UTSW	14	25655247	missense	probably damaging	1.00
R0255:Zmiz1	UTSW	14	25654495	splice site	probably benign
R1006:Zmiz1	UTSW	14	25662980	missense	unknown
R1160:Zmiz1	UTSW	14	25654512	missense	probably damaging	1.00
R1222:Zmiz1	UTSW	14	25658096	splice site	probably benign
R2846:Zmiz1	UTSW	14	25645675	missense	probably benign	0.03
R4126:Zmiz1	UTSW	14	25656930	missense	possibly damaging	0.94
R4373:Zmiz1	UTSW	14	25636010	missense	probably damaging	0.97
R4374:Zmiz1	UTSW	14	25636010	missense	probably damaging	0.97
R4377:Zmiz1	UTSW	14	25636010	missense	probably damaging	0.97
R4533:Zmiz1	UTSW	14	25645660	missense	probably damaging	1.00
R4726:Zmiz1	UTSW	14	25643674	critical splice donor site	probably null
R5385:Zmiz1	UTSW	14	25649813	missense	probably damaging	1.00
R5579:Zmiz1	UTSW	14	25644856	missense	probably damaging	0.96
R5761:Zmiz1	UTSW	14	25651304	missense	possibly damaging	0.86
R5761:Zmiz1	UTSW	14	25651306	missense	probably damaging	1.00
R5844:Zmiz1	UTSW	14	25656930	missense	probably damaging	1.00
R5875:Zmiz1	UTSW	14	25635966	missense	possibly damaging	0.55
R6051:Zmiz1	UTSW	14	25572070	start codon destroyed	probably null	0.53
R6919:Zmiz1	UTSW	14	25643638	missense	probably damaging	1.00
R7083:Zmiz1	UTSW	14	25651948	missense	probably damaging	1.00
R7216:Zmiz1	UTSW	14	25576200	frame shift	probably null
R7216:Zmiz1	UTSW	14	25576207	missense	probably damaging	0.99
R7216:Zmiz1	UTSW	14	25576209	missense	probably damaging	0.99
R7233:Zmiz1	UTSW	14	25649668	missense	possibly damaging	0.61
R8674:Zmiz1	UTSW	14	25646986	missense	probably benign	0.00
R8772:Zmiz1	UTSW	14	25645694	missense	probably damaging	1.00
R9610:Zmiz1	UTSW	14	25650598	missense	probably benign	0.00
R9611:Zmiz1	UTSW	14	25650598	missense	probably benign	0.00
R9632:Zmiz1	UTSW	14	25662987	missense	unknown
R9740:Zmiz1	UTSW	14	25656826	missense	possibly damaging	0.79
X0023:Zmiz1	UTSW	14	25649684	missense	probably damaging	0.96
Z1176:Zmiz1	UTSW	14	25645744	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATACCCACCTTGCAGAGCAG -3'
(R):5'- TCTCATCTAAGACATATTGGCCC -3'

Sequencing Primer
(F):5'- CCTTGCAGAGCAGAGGTG -3'
(R):5'- CCCCCAAGTCCGGGTATTC -3'

Posted On

2016-07-22