Incidental Mutation 'R5295:Zmiz1'
ID405373
Institutional Source Beutler Lab
Gene Symbol Zmiz1
Ensembl Gene ENSMUSG00000007817
Gene Namezinc finger, MIZ-type containing 1
SynonymsRai17, Zimp10
MMRRC Submission 042878-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5295 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location25459185-25666743 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 25656347 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 800 (L800P)
Ref Sequence ENSEMBL: ENSMUSP00000124863 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007961] [ENSMUST00000162645]
Predicted Effect probably damaging
Transcript: ENSMUST00000007961
AA Change: L794P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000007961
Gene: ENSMUSG00000007817
AA Change: L794P

DomainStartEndE-ValueType
low complexity region 123 142 N/A INTRINSIC
low complexity region 183 201 N/A INTRINSIC
low complexity region 239 268 N/A INTRINSIC
SCOP:d1gkub1 280 323 1e-3 SMART
low complexity region 431 446 N/A INTRINSIC
low complexity region 483 495 N/A INTRINSIC
low complexity region 498 505 N/A INTRINSIC
low complexity region 511 526 N/A INTRINSIC
Pfam:zf-Nse 731 786 3.5e-8 PFAM
Pfam:zf-MIZ 739 788 7.6e-26 PFAM
low complexity region 867 881 N/A INTRINSIC
low complexity region 982 997 N/A INTRINSIC
low complexity region 1039 1062 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162546
Predicted Effect probably damaging
Transcript: ENSMUST00000162645
AA Change: L800P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124863
Gene: ENSMUSG00000007817
AA Change: L800P

DomainStartEndE-ValueType
low complexity region 123 142 N/A INTRINSIC
low complexity region 183 201 N/A INTRINSIC
low complexity region 239 268 N/A INTRINSIC
SCOP:d1gkub1 280 309 2e-3 SMART
low complexity region 437 452 N/A INTRINSIC
low complexity region 489 501 N/A INTRINSIC
low complexity region 504 511 N/A INTRINSIC
low complexity region 517 532 N/A INTRINSIC
Pfam:zf-MIZ 745 794 2.1e-26 PFAM
low complexity region 873 887 N/A INTRINSIC
low complexity region 988 1003 N/A INTRINSIC
low complexity region 1045 1068 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the PIAS (protein inhibitor of activated STAT) family of proteins. The encoded protein regulates the activity of various transcription factors, including the androgen receptor, Smad3/4, and p53. The encoded protein may also play a role in sumoylation. A translocation between this locus on chromosome 10 and the protein tyrosine kinase ABL1 locus on chromosome 9 has been associated with acute lymphoblastic leukemia. [provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for a null mutation display embryonic lethality during organogenesis with failure of yolk sac vascular remodeling and abnormal embryonic vascular development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alpk2 C T 18: 65,305,038 E1095K probably damaging Het
Alpl T C 4: 137,749,608 T245A probably benign Het
Ank2 T C 3: 127,032,183 H378R probably damaging Het
Arhgef1 G A 7: 24,919,352 probably null Het
Atp5c1 T C 2: 10,068,733 R10G possibly damaging Het
Cbln3 T C 14: 55,883,463 probably null Het
Ccr10 C T 11: 101,174,285 V140M possibly damaging Het
Cep135 T A 5: 76,593,204 H42Q possibly damaging Het
Commd5 C A 15: 76,900,952 T183K possibly damaging Het
Dnajc16 T C 4: 141,767,928 E493G possibly damaging Het
Ears2 T C 7: 122,048,198 R288G probably damaging Het
Elovl4 G A 9: 83,780,661 P273L possibly damaging Het
Fam186b T A 15: 99,283,874 I148F probably damaging Het
Fryl T C 5: 73,112,791 Y79C probably damaging Het
Gad1-ps A G 10: 99,444,889 noncoding transcript Het
Gm14325 G A 2: 177,832,984 H102Y possibly damaging Het
Gm8882 T G 6: 132,361,877 Q126P unknown Het
Ighv1-77 T A 12: 115,861,908 S104C probably damaging Het
Kcnv1 T C 15: 45,114,591 D17G unknown Het
Lmtk3 G A 7: 45,791,298 D243N probably damaging Het
Lrrc7 T A 3: 158,170,739 K571N probably damaging Het
Lsm7 T C 10: 80,854,620 E32G probably damaging Het
Ly6f A G 15: 75,271,639 Q65R probably benign Het
Perm1 T C 4: 156,217,518 L173P probably benign Het
Plvap T C 8: 71,511,670 Q16R probably benign Het
Prl7d1 A T 13: 27,709,247 V227D probably damaging Het
Prss54 T C 8: 95,564,478 T165A probably damaging Het
Psrc1 A G 3: 108,386,359 I195V probably benign Het
Rnf123 AT ATT 9: 108,064,003 probably null Het
Rnf213 A T 11: 119,440,816 T2284S probably benign Het
Serpina3c T C 12: 104,148,378 E333G probably damaging Het
Serpinb6c A G 13: 33,893,817 F190S probably damaging Het
Sfmbt1 G A 14: 30,774,029 D90N probably damaging Het
Tdh T C 14: 63,496,109 Y110C probably damaging Het
Tdrd9 T A 12: 112,051,912 L1255* probably null Het
Trim41 TTCCTCCTCCTCCTCCTCCTCCTCCTCC TTCCTCCTCCTCCTCCTCCTCCTCC 11: 48,816,257 probably benign Het
Vps51 T G 19: 6,071,033 E283D probably benign Het
Zbtb2 T C 10: 4,368,508 K506R probably damaging Het
Znhit6 A G 3: 145,600,493 D251G probably benign Het
Other mutations in Zmiz1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00553:Zmiz1 APN 14 25572070 start codon destroyed probably null 0.53
IGL01582:Zmiz1 APN 14 25658230 missense probably benign 0.00
IGL01601:Zmiz1 APN 14 25581644 missense possibly damaging 0.68
IGL02008:Zmiz1 APN 14 25656879 missense probably damaging 0.97
IGL02395:Zmiz1 APN 14 25656763 missense probably damaging 1.00
IGL02836:Zmiz1 APN 14 25656742 splice site probably benign
zapp UTSW 14 25662980 missense unknown
R0144:Zmiz1 UTSW 14 25655247 missense probably damaging 1.00
R0255:Zmiz1 UTSW 14 25654495 splice site probably benign
R1006:Zmiz1 UTSW 14 25662980 missense unknown
R1160:Zmiz1 UTSW 14 25654512 missense probably damaging 1.00
R1222:Zmiz1 UTSW 14 25658096 splice site probably benign
R2846:Zmiz1 UTSW 14 25645675 missense probably benign 0.03
R4126:Zmiz1 UTSW 14 25656930 missense possibly damaging 0.94
R4373:Zmiz1 UTSW 14 25636010 missense probably damaging 0.97
R4374:Zmiz1 UTSW 14 25636010 missense probably damaging 0.97
R4377:Zmiz1 UTSW 14 25636010 missense probably damaging 0.97
R4533:Zmiz1 UTSW 14 25645660 missense probably damaging 1.00
R4726:Zmiz1 UTSW 14 25643674 critical splice donor site probably null
R5385:Zmiz1 UTSW 14 25649813 missense probably damaging 1.00
R5579:Zmiz1 UTSW 14 25644856 missense probably damaging 0.96
R5761:Zmiz1 UTSW 14 25651304 missense possibly damaging 0.86
R5761:Zmiz1 UTSW 14 25651306 missense probably damaging 1.00
R5844:Zmiz1 UTSW 14 25656930 missense probably damaging 1.00
R5875:Zmiz1 UTSW 14 25635966 missense possibly damaging 0.55
R6051:Zmiz1 UTSW 14 25572070 start codon destroyed probably null 0.53
R6919:Zmiz1 UTSW 14 25643638 missense probably damaging 1.00
R7083:Zmiz1 UTSW 14 25651948 missense probably damaging 1.00
R7216:Zmiz1 UTSW 14 25576200 frame shift probably null
R7216:Zmiz1 UTSW 14 25576207 missense probably damaging 0.99
R7216:Zmiz1 UTSW 14 25576209 missense probably damaging 0.99
R7233:Zmiz1 UTSW 14 25649668 missense possibly damaging 0.61
X0023:Zmiz1 UTSW 14 25649684 missense probably damaging 0.96
Z1176:Zmiz1 UTSW 14 25645744 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATACCCACCTTGCAGAGCAG -3'
(R):5'- TCTCATCTAAGACATATTGGCCC -3'

Sequencing Primer
(F):5'- CCTTGCAGAGCAGAGGTG -3'
(R):5'- CCCCCAAGTCCGGGTATTC -3'
Posted On2016-07-22