Incidental Mutation 'R5295:Cbln3'
ID405375
Institutional Source Beutler Lab
Gene Symbol Cbln3
Ensembl Gene ENSMUSG00000040380
Gene Namecerebellin 3 precursor protein
Synonyms
MMRRC Submission 042878-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5295 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location55878913-55884392 bp(-) (GRCm38)
Type of Mutationsplice site (4 bp from exon)
DNA Base Change (assembly) T to C at 55883463 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000127798 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022831] [ENSMUST00000063871] [ENSMUST00000172378] [ENSMUST00000228462]
Predicted Effect probably benign
Transcript: ENSMUST00000022831
SMART Domains Protein: ENSMUSP00000022831
Gene: ENSMUSG00000047153

DomainStartEndE-ValueType
low complexity region 350 365 N/A INTRINSIC
low complexity region 367 380 N/A INTRINSIC
Pfam:RNase_Zc3h12a 429 582 1.9e-66 PFAM
low complexity region 623 637 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000063871
SMART Domains Protein: ENSMUSP00000070494
Gene: ENSMUSG00000040380

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
C1Q 57 197 6.3e-40 SMART
Predicted Effect probably null
Transcript: ENSMUST00000172378
SMART Domains Protein: ENSMUSP00000127798
Gene: ENSMUSG00000040380

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
C1Q 57 197 6.3e-40 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227462
Predicted Effect probably benign
Transcript: ENSMUST00000228462
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the precerebellin family, such as CBLN3, contain a cerebellin motif (see CBLN1; MIM 600432) and a C-terminal C1q signature domain (see MIM 120550) that mediates trimeric assembly of atypical collagen complexes. However, precerebellins do not contain a collagen motif, suggesting that they are not conventional components of the extracellular matrix (Pang et al., 2000 [PubMed 10964938]).[supplied by OMIM, Aug 2009]
PHENOTYPE: Mice homozygous for a knock-out allele are viable, fertile and behaviorally normal with no apparent defects in cerebellar foliation and lamination or Purkinje cell morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alpk2 C T 18: 65,305,038 E1095K probably damaging Het
Alpl T C 4: 137,749,608 T245A probably benign Het
Ank2 T C 3: 127,032,183 H378R probably damaging Het
Arhgef1 G A 7: 24,919,352 probably null Het
Atp5c1 T C 2: 10,068,733 R10G possibly damaging Het
Ccr10 C T 11: 101,174,285 V140M possibly damaging Het
Cep135 T A 5: 76,593,204 H42Q possibly damaging Het
Commd5 C A 15: 76,900,952 T183K possibly damaging Het
Dnajc16 T C 4: 141,767,928 E493G possibly damaging Het
Ears2 T C 7: 122,048,198 R288G probably damaging Het
Elovl4 G A 9: 83,780,661 P273L possibly damaging Het
Fam186b T A 15: 99,283,874 I148F probably damaging Het
Fryl T C 5: 73,112,791 Y79C probably damaging Het
Gad1-ps A G 10: 99,444,889 noncoding transcript Het
Gm14325 G A 2: 177,832,984 H102Y possibly damaging Het
Gm8882 T G 6: 132,361,877 Q126P unknown Het
Ighv1-77 T A 12: 115,861,908 S104C probably damaging Het
Kcnv1 T C 15: 45,114,591 D17G unknown Het
Lmtk3 G A 7: 45,791,298 D243N probably damaging Het
Lrrc7 T A 3: 158,170,739 K571N probably damaging Het
Lsm7 T C 10: 80,854,620 E32G probably damaging Het
Ly6f A G 15: 75,271,639 Q65R probably benign Het
Perm1 T C 4: 156,217,518 L173P probably benign Het
Plvap T C 8: 71,511,670 Q16R probably benign Het
Prl7d1 A T 13: 27,709,247 V227D probably damaging Het
Prss54 T C 8: 95,564,478 T165A probably damaging Het
Psrc1 A G 3: 108,386,359 I195V probably benign Het
Rnf123 AT ATT 9: 108,064,003 probably null Het
Rnf213 A T 11: 119,440,816 T2284S probably benign Het
Serpina3c T C 12: 104,148,378 E333G probably damaging Het
Serpinb6c A G 13: 33,893,817 F190S probably damaging Het
Sfmbt1 G A 14: 30,774,029 D90N probably damaging Het
Tdh T C 14: 63,496,109 Y110C probably damaging Het
Tdrd9 T A 12: 112,051,912 L1255* probably null Het
Trim41 TTCCTCCTCCTCCTCCTCCTCCTCCTCC TTCCTCCTCCTCCTCCTCCTCCTCC 11: 48,816,257 probably benign Het
Vps51 T G 19: 6,071,033 E283D probably benign Het
Zbtb2 T C 10: 4,368,508 K506R probably damaging Het
Zmiz1 T C 14: 25,656,347 L800P probably damaging Het
Znhit6 A G 3: 145,600,493 D251G probably benign Het
Other mutations in Cbln3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02820:Cbln3 APN 14 55883487 missense probably damaging 1.00
PIT4504001:Cbln3 UTSW 14 55883499 missense probably damaging 1.00
R0417:Cbln3 UTSW 14 55884129 missense probably benign 0.01
R2210:Cbln3 UTSW 14 55883926 missense possibly damaging 0.61
R2472:Cbln3 UTSW 14 55884081 missense possibly damaging 0.80
R4524:Cbln3 UTSW 14 55884065 nonsense probably null
R5746:Cbln3 UTSW 14 55883144 missense probably damaging 1.00
R6179:Cbln3 UTSW 14 55884060 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- ATGTCCTAGTCCTTAGCTCAGG -3'
(R):5'- AACCCAGTGATGCTCCTGAG -3'

Sequencing Primer
(F):5'- TTAGCTCAGGACACCCCG -3'
(R):5'- TCCTGAGCTCCCGGCAC -3'
Posted On2016-07-22