Incidental Mutation 'R5295:Tdh'
ID405376
Institutional Source Beutler Lab
Gene Symbol Tdh
Ensembl Gene ENSMUSG00000021953
Gene NameL-threonine dehydrogenase
Synonyms
MMRRC Submission 042878-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.233) question?
Stock #R5295 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location63492347-63509092 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 63496109 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 110 (Y110C)
Ref Sequence ENSEMBL: ENSMUSP00000022522 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022522] [ENSMUST00000165776] [ENSMUST00000168488] [ENSMUST00000168669]
Predicted Effect probably damaging
Transcript: ENSMUST00000022522
AA Change: Y110C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000022522
Gene: ENSMUSG00000021953
AA Change: Y110C

DomainStartEndE-ValueType
Pfam:RmlD_sub_bind 56 252 3.3e-10 PFAM
Pfam:Epimerase 58 294 5.8e-22 PFAM
Pfam:3Beta_HSD 59 185 7e-9 PFAM
Pfam:GDP_Man_Dehyd 59 359 1.4e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164515
Predicted Effect probably benign
Transcript: ENSMUST00000165776
SMART Domains Protein: ENSMUSP00000129206
Gene: ENSMUSG00000021953

DomainStartEndE-ValueType
SCOP:d1kc0a_ 42 149 3e-11 SMART
PDB:3A4V|B 43 144 3e-18 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000168488
SMART Domains Protein: ENSMUSP00000131068
Gene: ENSMUSG00000021953

DomainStartEndE-ValueType
SCOP:d1kc0a_ 42 140 5e-11 SMART
PDB:3A4V|B 43 148 1e-18 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000168669
AA Change: Y95C

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000132119
Gene: ENSMUSG00000021953
AA Change: Y95C

DomainStartEndE-ValueType
Pfam:RmlD_sub_bind 41 205 6.9e-10 PFAM
Pfam:Polysacc_synt_2 43 164 2.2e-6 PFAM
Pfam:Epimerase 43 200 9.2e-13 PFAM
Pfam:3Beta_HSD 44 168 5.1e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170772
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alpk2 C T 18: 65,305,038 E1095K probably damaging Het
Alpl T C 4: 137,749,608 T245A probably benign Het
Ank2 T C 3: 127,032,183 H378R probably damaging Het
Arhgef1 G A 7: 24,919,352 probably null Het
Atp5c1 T C 2: 10,068,733 R10G possibly damaging Het
Cbln3 T C 14: 55,883,463 probably null Het
Ccr10 C T 11: 101,174,285 V140M possibly damaging Het
Cep135 T A 5: 76,593,204 H42Q possibly damaging Het
Commd5 C A 15: 76,900,952 T183K possibly damaging Het
Dnajc16 T C 4: 141,767,928 E493G possibly damaging Het
Ears2 T C 7: 122,048,198 R288G probably damaging Het
Elovl4 G A 9: 83,780,661 P273L possibly damaging Het
Fam186b T A 15: 99,283,874 I148F probably damaging Het
Fryl T C 5: 73,112,791 Y79C probably damaging Het
Gad1-ps A G 10: 99,444,889 noncoding transcript Het
Gm14325 G A 2: 177,832,984 H102Y possibly damaging Het
Gm8882 T G 6: 132,361,877 Q126P unknown Het
Ighv1-77 T A 12: 115,861,908 S104C probably damaging Het
Kcnv1 T C 15: 45,114,591 D17G unknown Het
Lmtk3 G A 7: 45,791,298 D243N probably damaging Het
Lrrc7 T A 3: 158,170,739 K571N probably damaging Het
Lsm7 T C 10: 80,854,620 E32G probably damaging Het
Ly6f A G 15: 75,271,639 Q65R probably benign Het
Perm1 T C 4: 156,217,518 L173P probably benign Het
Plvap T C 8: 71,511,670 Q16R probably benign Het
Prl7d1 A T 13: 27,709,247 V227D probably damaging Het
Prss54 T C 8: 95,564,478 T165A probably damaging Het
Psrc1 A G 3: 108,386,359 I195V probably benign Het
Rnf123 AT ATT 9: 108,064,003 probably null Het
Rnf213 A T 11: 119,440,816 T2284S probably benign Het
Serpina3c T C 12: 104,148,378 E333G probably damaging Het
Serpinb6c A G 13: 33,893,817 F190S probably damaging Het
Sfmbt1 G A 14: 30,774,029 D90N probably damaging Het
Tdrd9 T A 12: 112,051,912 L1255* probably null Het
Trim41 TTCCTCCTCCTCCTCCTCCTCCTCCTCC TTCCTCCTCCTCCTCCTCCTCCTCC 11: 48,816,257 probably benign Het
Vps51 T G 19: 6,071,033 E283D probably benign Het
Zbtb2 T C 10: 4,368,508 K506R probably damaging Het
Zmiz1 T C 14: 25,656,347 L800P probably damaging Het
Znhit6 A G 3: 145,600,493 D251G probably benign Het
Other mutations in Tdh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00843:Tdh APN 14 63495764 missense probably damaging 1.00
IGL02047:Tdh APN 14 63496958 missense probably benign 0.07
R0126:Tdh UTSW 14 63497593 splice site probably benign
R1530:Tdh UTSW 14 63496055 missense probably damaging 1.00
R3748:Tdh UTSW 14 63495993 missense probably benign 0.26
R4589:Tdh UTSW 14 63495877 missense probably damaging 1.00
R4646:Tdh UTSW 14 63493756 missense possibly damaging 0.51
R4647:Tdh UTSW 14 63493756 missense possibly damaging 0.51
R4648:Tdh UTSW 14 63493756 missense possibly damaging 0.51
R5038:Tdh UTSW 14 63496126 nonsense probably null
R5275:Tdh UTSW 14 63496109 missense probably damaging 1.00
R6319:Tdh UTSW 14 63495737 missense probably benign 0.00
R6825:Tdh UTSW 14 63495832 missense probably damaging 0.99
R7218:Tdh UTSW 14 63495757 missense probably damaging 1.00
R7528:Tdh UTSW 14 63494011 missense probably damaging 1.00
R7732:Tdh UTSW 14 63496058 missense probably damaging 1.00
R8238:Tdh UTSW 14 63495724 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTACCAAGAGCCGGAACAACTG -3'
(R):5'- TGGCTGTTAACCCAGTGCTC -3'

Sequencing Primer
(F):5'- AACTGGCCCCCACTGAG -3'
(R):5'- CTGTTAACCCAGTGCTCAGAAGG -3'
Posted On2016-07-22