Incidental Mutation 'R0497:Cntnap4'
ID40538
Institutional Source Beutler Lab
Gene Symbol Cntnap4
Ensembl Gene ENSMUSG00000031772
Gene Namecontactin associated protein-like 4
SynonymsE130114F09Rik, Caspr4
MMRRC Submission 038693-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R0497 (G1)
Quality Score200
Status Validated
Chromosome8
Chromosomal Location112570043-112882717 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 112570151 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 6 (V6A)
Ref Sequence ENSEMBL: ENSMUSP00000112511 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034225] [ENSMUST00000118171]
Predicted Effect probably benign
Transcript: ENSMUST00000034225
AA Change: V6A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000034225
Gene: ENSMUSG00000031772
AA Change: V6A

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
FA58C 32 179 2.35e-19 SMART
LamG 206 343 5.14e-25 SMART
LamG 392 526 1.04e-25 SMART
EGF 554 588 1.4e0 SMART
Blast:FBG 591 775 1e-120 BLAST
LamG 815 942 1.01e-32 SMART
EGF 963 999 1.36e1 SMART
LamG 1040 1178 7.8e-16 SMART
transmembrane domain 1244 1266 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118171
AA Change: V6A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000112511
Gene: ENSMUSG00000031772
AA Change: V6A

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
FA58C 32 179 2.35e-19 SMART
LamG 206 343 5.14e-25 SMART
LamG 392 526 1.04e-25 SMART
EGF 554 588 1.4e0 SMART
Blast:FBG 591 775 1e-120 BLAST
LamG 815 942 1.01e-32 SMART
EGF 963 999 1.36e1 SMART
LamG 1040 1178 2.06e-15 SMART
transmembrane domain 1244 1266 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125196
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125976
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182027
Meta Mutation Damage Score 0.1184 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.7%
  • 10x: 96.6%
  • 20x: 93.1%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the neurexin protein family. Members of this family function in the vertebrate nervous system as cell adhesion molecules and receptors. This protein contains epidermal growth factor repeats and laminin G domains. In addition, it includes an F5/8 type C domain, discoidin/neuropilin- and fibrinogen-like domains, and thrombospondin N-terminal-like domains. This protein may also play a role in proper neurotransmission in the dopaminergic and GABAergic systems and mutations in this gene may be associated with certain psychiatric illnesses. A polymorphism in an intron of this gene may be associated with longevity. [provided by RefSeq, Apr 2016]
PHENOTYPE: Homozygous knock-out mice show increased midbrain dopaminergic release in the nucleus accumbens, synaptic defects, impaired sensory-motor gating, and increased grooming behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik T A 7: 28,147,465 C1158S probably damaging Het
Aatk A C 11: 120,018,780 V110G probably damaging Het
Adcy6 A C 15: 98,597,725 probably null Het
Adm A G 7: 110,629,121 T170A probably benign Het
Afap1l2 G T 19: 56,930,209 N171K probably benign Het
Aph1b G T 9: 66,790,618 S112* probably null Het
Arhgap23 A G 11: 97,452,163 S424G probably damaging Het
Asah2 T A 19: 32,054,631 N46I probably benign Het
Braf G A 6: 39,640,549 probably benign Het
Brd2 C T 17: 34,114,360 R47Q probably damaging Het
C2cd5 A G 6: 143,012,093 V972A probably benign Het
Car9 T A 4: 43,511,881 L300H probably damaging Het
Chmp3 T C 6: 71,552,411 S20P probably damaging Het
Chp1 A G 2: 119,571,782 N79S possibly damaging Het
Cnot2 A T 10: 116,498,355 I335N probably damaging Het
Ctcf T A 8: 105,675,040 probably benign Het
Dennd1b A G 1: 139,039,986 probably benign Het
Dirc2 A T 16: 35,735,604 V162D probably benign Het
Dnmbp A G 19: 43,856,640 probably benign Het
Eef2 T C 10: 81,181,586 F782L probably benign Het
Eogt T A 6: 97,135,233 Y153F probably benign Het
Fam81a G T 9: 70,096,119 Q237K possibly damaging Het
Fat2 T A 11: 55,283,402 T2162S probably benign Het
Gas6 T C 8: 13,470,387 I434V possibly damaging Het
Gm42417 A T 1: 36,532,167 L77Q probably damaging Het
Grik3 A T 4: 125,623,510 N49Y possibly damaging Het
Gucy2e A T 11: 69,224,159 V974E probably damaging Het
Helz2 A G 2: 181,229,656 V2721A probably damaging Het
Klhl6 GT G 16: 19,956,966 probably null Het
Krt73 A G 15: 101,802,230 L23P probably damaging Het
L3mbtl3 T C 10: 26,282,874 probably benign Het
Lrrc15 A T 16: 30,272,892 V543E probably damaging Het
Med13 G A 11: 86,276,983 probably benign Het
Med25 T C 7: 44,892,100 D60G probably damaging Het
Mgam T A 6: 40,664,892 Y560N probably damaging Het
Mlkl A G 8: 111,327,873 Y211H probably damaging Het
Msl2 A G 9: 101,101,294 N289S probably benign Het
Nwd2 G T 5: 63,806,343 W1090L probably damaging Het
Olfr1281 A G 2: 111,328,830 D137G probably benign Het
Omt2b T C 9: 78,328,231 probably benign Het
Pald1 A G 10: 61,341,315 L652P probably damaging Het
Pard3b T A 1: 62,440,008 probably null Het
Prdm15 G A 16: 97,794,334 T1098I possibly damaging Het
Rock2 A G 12: 16,954,953 T436A probably benign Het
Sema4c A T 1: 36,549,608 D812E probably benign Het
Sla A T 15: 66,792,249 I91K probably benign Het
Slc22a16 T G 10: 40,584,967 M255R probably damaging Het
Smg8 C T 11: 87,086,084 D224N possibly damaging Het
Spdef A T 17: 27,718,058 D190E probably benign Het
Taok1 A G 11: 77,573,804 I152T probably damaging Het
Tmem220 A G 11: 67,025,922 D36G probably damaging Het
Tmem235 A C 11: 117,864,351 I210L probably benign Het
Tmem266 C T 9: 55,380,884 probably null Het
Tmprss12 A G 15: 100,281,039 probably benign Het
Trim32 G A 4: 65,613,254 R16Q probably damaging Het
Usp38 T A 8: 80,984,424 probably benign Het
Usp44 C T 10: 93,846,806 P373S possibly damaging Het
Vmn1r209 G T 13: 22,805,948 Q191K probably damaging Het
Vmn1r70 T C 7: 10,634,026 I147T probably benign Het
Vmn2r107 T A 17: 20,375,132 I649N probably damaging Het
Vmn2r12 A T 5: 109,091,889 Y269* probably null Het
Zan C T 5: 137,412,676 probably benign Het
Zfp616 G T 11: 74,083,480 V192L probably benign Het
Zfp644 A T 5: 106,638,333 V116D probably damaging Het
Zgrf1 T C 3: 127,584,650 probably benign Het
Zhx3 A T 2: 160,779,994 L751* probably null Het
Znfx1 T A 2: 167,055,411 Q531L probably benign Het
Other mutations in Cntnap4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00847:Cntnap4 APN 8 112767619 splice site probably benign
IGL01898:Cntnap4 APN 8 112856307 missense possibly damaging 0.46
IGL01918:Cntnap4 APN 8 112752234 missense possibly damaging 0.67
IGL02257:Cntnap4 APN 8 112616494 missense probably damaging 1.00
IGL02302:Cntnap4 APN 8 112785903 splice site probably benign
IGL02621:Cntnap4 APN 8 112810723 missense probably damaging 1.00
IGL03008:Cntnap4 APN 8 112773590 missense probably benign 0.06
IGL03327:Cntnap4 APN 8 112773576 missense probably benign 0.00
IGL03346:Cntnap4 APN 8 112773576 missense probably benign 0.00
R0025:Cntnap4 UTSW 8 112803164 missense probably damaging 1.00
R0025:Cntnap4 UTSW 8 112803164 missense probably damaging 1.00
R0058:Cntnap4 UTSW 8 112785784 missense probably damaging 0.98
R0310:Cntnap4 UTSW 8 112842516 critical splice acceptor site probably null
R0363:Cntnap4 UTSW 8 112856511 nonsense probably null
R1495:Cntnap4 UTSW 8 112881763 missense possibly damaging 0.81
R1579:Cntnap4 UTSW 8 112881830 missense possibly damaging 0.89
R1704:Cntnap4 UTSW 8 112757523 missense probably damaging 1.00
R1943:Cntnap4 UTSW 8 112815496 missense probably benign 0.10
R2160:Cntnap4 UTSW 8 112757571 missense probably damaging 1.00
R2226:Cntnap4 UTSW 8 112815488 missense probably damaging 0.98
R3148:Cntnap4 UTSW 8 112757439 missense probably damaging 1.00
R3916:Cntnap4 UTSW 8 112875533 missense probably benign 0.02
R3917:Cntnap4 UTSW 8 112875533 missense probably benign 0.02
R4097:Cntnap4 UTSW 8 112752307 missense probably benign 0.03
R4348:Cntnap4 UTSW 8 112753922 missense probably damaging 1.00
R4469:Cntnap4 UTSW 8 112665266 missense probably damaging 1.00
R4530:Cntnap4 UTSW 8 112858210 missense probably benign 0.32
R4531:Cntnap4 UTSW 8 112810608 missense possibly damaging 0.90
R4586:Cntnap4 UTSW 8 112810710 missense probably benign
R4611:Cntnap4 UTSW 8 112773739 critical splice donor site probably null
R4675:Cntnap4 UTSW 8 112785836 missense probably damaging 1.00
R4801:Cntnap4 UTSW 8 112773590 missense possibly damaging 0.94
R4802:Cntnap4 UTSW 8 112773590 missense possibly damaging 0.94
R5273:Cntnap4 UTSW 8 112733438 missense probably damaging 1.00
R6114:Cntnap4 UTSW 8 112841753 missense probably damaging 1.00
R6194:Cntnap4 UTSW 8 112875429 missense probably damaging 1.00
R6222:Cntnap4 UTSW 8 112842721 missense probably damaging 1.00
R6262:Cntnap4 UTSW 8 112803211 missense probably damaging 0.99
R6276:Cntnap4 UTSW 8 112752289 missense possibly damaging 0.94
R6483:Cntnap4 UTSW 8 112757473 missense possibly damaging 0.82
R6819:Cntnap4 UTSW 8 112803226 missense probably benign 0.03
R7031:Cntnap4 UTSW 8 112858242 missense probably benign 0.01
R7107:Cntnap4 UTSW 8 112815488 missense probably damaging 0.98
R7146:Cntnap4 UTSW 8 112810636 missense probably damaging 1.00
R7192:Cntnap4 UTSW 8 112881800 missense probably benign 0.05
R7232:Cntnap4 UTSW 8 112665099 splice site probably null
R7348:Cntnap4 UTSW 8 112665277 missense probably damaging 1.00
R7482:Cntnap4 UTSW 8 112733562 critical splice donor site probably null
R7832:Cntnap4 UTSW 8 112757481 missense probably benign
R7895:Cntnap4 UTSW 8 112752197 missense probably damaging 0.99
R7915:Cntnap4 UTSW 8 112757481 missense probably benign
R7978:Cntnap4 UTSW 8 112752197 missense probably damaging 0.99
R8014:Cntnap4 UTSW 8 112753945 missense not run
X0025:Cntnap4 UTSW 8 112859143 missense probably damaging 1.00
X0063:Cntnap4 UTSW 8 112875579 missense probably benign 0.05
Z1088:Cntnap4 UTSW 8 112815520 missense probably damaging 1.00
Z1176:Cntnap4 UTSW 8 112858189 missense not run
Predicted Primers PCR Primer
(F):5'- TGCTGGGGCAAATTTCTAAGACCG -3'
(R):5'- CCGCAGCGATTCCAGTTGAAAAG -3'

Sequencing Primer
(F):5'- gaaagagagagagaaagagagagag -3'
(R):5'- TGAATTCCCAGCTTCCACTC -3'
Posted On2013-05-23