Incidental Mutation 'R5295:Fam186b'
ID405380
Institutional Source Beutler Lab
Gene Symbol Fam186b
Ensembl Gene ENSMUSG00000078907
Gene Namefamily with sequence similarity 186, member B
SynonymsEG545136
MMRRC Submission 042878-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5295 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location99271018-99295888 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 99283874 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 148 (I148F)
Ref Sequence ENSEMBL: ENSMUSP00000104728 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109100] [ENSMUST00000230608]
Predicted Effect probably damaging
Transcript: ENSMUST00000109100
AA Change: I148F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000104728
Gene: ENSMUSG00000078907
AA Change: I148F

DomainStartEndE-ValueType
Blast:FBG 12 193 1e-19 BLAST
low complexity region 354 363 N/A INTRINSIC
low complexity region 478 493 N/A INTRINSIC
low complexity region 508 522 N/A INTRINSIC
low complexity region 789 810 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000230608
AA Change: I16F

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product is a member of the FAM186 family, however, its exact function is not known. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2009]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alpk2 C T 18: 65,305,038 E1095K probably damaging Het
Alpl T C 4: 137,749,608 T245A probably benign Het
Ank2 T C 3: 127,032,183 H378R probably damaging Het
Arhgef1 G A 7: 24,919,352 probably null Het
Atp5c1 T C 2: 10,068,733 R10G possibly damaging Het
Cbln3 T C 14: 55,883,463 probably null Het
Ccr10 C T 11: 101,174,285 V140M possibly damaging Het
Cep135 T A 5: 76,593,204 H42Q possibly damaging Het
Commd5 C A 15: 76,900,952 T183K possibly damaging Het
Dnajc16 T C 4: 141,767,928 E493G possibly damaging Het
Ears2 T C 7: 122,048,198 R288G probably damaging Het
Elovl4 G A 9: 83,780,661 P273L possibly damaging Het
Fryl T C 5: 73,112,791 Y79C probably damaging Het
Gad1-ps A G 10: 99,444,889 noncoding transcript Het
Gm14325 G A 2: 177,832,984 H102Y possibly damaging Het
Gm8882 T G 6: 132,361,877 Q126P unknown Het
Ighv1-77 T A 12: 115,861,908 S104C probably damaging Het
Kcnv1 T C 15: 45,114,591 D17G unknown Het
Lmtk3 G A 7: 45,791,298 D243N probably damaging Het
Lrrc7 T A 3: 158,170,739 K571N probably damaging Het
Lsm7 T C 10: 80,854,620 E32G probably damaging Het
Ly6f A G 15: 75,271,639 Q65R probably benign Het
Perm1 T C 4: 156,217,518 L173P probably benign Het
Plvap T C 8: 71,511,670 Q16R probably benign Het
Prl7d1 A T 13: 27,709,247 V227D probably damaging Het
Prss54 T C 8: 95,564,478 T165A probably damaging Het
Psrc1 A G 3: 108,386,359 I195V probably benign Het
Rnf123 AT ATT 9: 108,064,003 probably null Het
Rnf213 A T 11: 119,440,816 T2284S probably benign Het
Serpina3c T C 12: 104,148,378 E333G probably damaging Het
Serpinb6c A G 13: 33,893,817 F190S probably damaging Het
Sfmbt1 G A 14: 30,774,029 D90N probably damaging Het
Tdh T C 14: 63,496,109 Y110C probably damaging Het
Tdrd9 T A 12: 112,051,912 L1255* probably null Het
Trim41 TTCCTCCTCCTCCTCCTCCTCCTCCTCC TTCCTCCTCCTCCTCCTCCTCCTCC 11: 48,816,257 probably benign Het
Vps51 T G 19: 6,071,033 E283D probably benign Het
Zbtb2 T C 10: 4,368,508 K506R probably damaging Het
Zmiz1 T C 14: 25,656,347 L800P probably damaging Het
Znhit6 A G 3: 145,600,493 D251G probably benign Het
Other mutations in Fam186b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01362:Fam186b APN 15 99280318 missense probably benign 0.00
IGL01729:Fam186b APN 15 99280251 missense probably benign 0.02
IGL01948:Fam186b APN 15 99280446 missense probably benign 0.00
IGL02133:Fam186b APN 15 99273703 missense probably damaging 0.96
IGL03010:Fam186b APN 15 99280627 missense possibly damaging 0.80
IGL03371:Fam186b APN 15 99280377 missense probably benign 0.00
R0457:Fam186b UTSW 15 99271285 missense probably benign 0.02
R0522:Fam186b UTSW 15 99280519 missense probably benign 0.00
R0571:Fam186b UTSW 15 99286953 missense probably benign 0.02
R0620:Fam186b UTSW 15 99280128 missense probably benign 0.34
R1575:Fam186b UTSW 15 99286971 missense probably benign 0.00
R1883:Fam186b UTSW 15 99278798 missense probably damaging 0.96
R2144:Fam186b UTSW 15 99280657 missense probably benign 0.00
R2267:Fam186b UTSW 15 99285643 missense probably damaging 0.99
R2332:Fam186b UTSW 15 99280428 missense probably benign 0.42
R2394:Fam186b UTSW 15 99280177 missense probably benign 0.01
R3624:Fam186b UTSW 15 99280515 missense probably benign 0.01
R4681:Fam186b UTSW 15 99280890 missense probably benign 0.00
R4811:Fam186b UTSW 15 99280237 missense probably benign 0.01
R4906:Fam186b UTSW 15 99271321 missense probably damaging 0.99
R5028:Fam186b UTSW 15 99280801 missense probably damaging 0.99
R5047:Fam186b UTSW 15 99280686 missense probably damaging 1.00
R5440:Fam186b UTSW 15 99273853 missense possibly damaging 0.75
R5468:Fam186b UTSW 15 99278870 missense possibly damaging 0.93
R5596:Fam186b UTSW 15 99271289 missense possibly damaging 0.90
R5759:Fam186b UTSW 15 99279717 missense probably benign 0.09
R6239:Fam186b UTSW 15 99280434 missense probably benign
R7117:Fam186b UTSW 15 99285590 missense probably damaging 0.98
R7141:Fam186b UTSW 15 99283892 missense probably benign 0.03
R7223:Fam186b UTSW 15 99279837 missense possibly damaging 0.77
R7301:Fam186b UTSW 15 99278748 missense probably benign 0.00
R7441:Fam186b UTSW 15 99280089 missense probably benign 0.00
R7614:Fam186b UTSW 15 99286986 missense probably damaging 1.00
R7825:Fam186b UTSW 15 99283847 missense not run
R7853:Fam186b UTSW 15 99280747 missense probably damaging 1.00
R7936:Fam186b UTSW 15 99280747 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGCTCAGAACTGCTTTGTGATC -3'
(R):5'- GGGGTCTCTAGAGGACAAACTG -3'

Sequencing Primer
(F):5'- ATCGGCATGGCTCGGTTAC -3'
(R):5'- GGACAAACTGTTCTCAGCCTG -3'
Posted On2016-07-22