Mutagenetix > Incidental Mutations

Incidental Mutation 'R5296:Satb2'

405386

Institutional Source

Beutler Lab

Gene Symbol

Satb2

Ensembl Gene

ENSMUSG00000038331

Gene Name

special AT-rich sequence binding protein 2

Synonyms

MMRRC Submission

042879-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5296 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

56793981-56978650 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 56796907 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 575 (E575G)

Ref Sequence

ENSEMBL: ENSMUSP00000135391 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000042857] [ENSMUST00000114415] [ENSMUST00000177424]

AlphaFold

Q8VI24

Predicted Effect

probably damaging
Transcript: ENSMUST00000042857
AA Change: E634G

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000046067
Gene: ENSMUSG00000038331
AA Change: E634G

Domain	Start	End	E-Value	Type
PDB:3TUO\|D	45	98	8e-19	PDB
PDB:3NZL\|A	106	174	4e-35	PDB
low complexity region	235	251	N/A	INTRINSIC
CUT	292	378	1.3e-36	SMART
low complexity region	381	399	N/A	INTRINSIC
CUT	415	501	3.58e-39	SMART
low complexity region	510	524	N/A	INTRINSIC
low complexity region	533	551	N/A	INTRINSIC
HOX	555	618	1.06e-7	SMART
low complexity region	629	650	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000114415
AA Change: E693G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000110057
Gene: ENSMUSG00000038331
AA Change: E693G

Domain	Start	End	E-Value	Type
Pfam:ULD	58	156	1.7e-39	PFAM
Pfam:CUTL	162	233	3.9e-46	PFAM
low complexity region	294	310	N/A	INTRINSIC
CUT	351	437	1.3e-36	SMART
low complexity region	440	458	N/A	INTRINSIC
CUT	474	560	3.58e-39	SMART
low complexity region	569	583	N/A	INTRINSIC
low complexity region	592	610	N/A	INTRINSIC
HOX	614	677	1.06e-7	SMART
low complexity region	688	709	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000177424
AA Change: E575G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000135391
Gene: ENSMUSG00000038331
AA Change: E575G

Domain	Start	End	E-Value	Type
PDB:3TUO\|D	57	115	6e-23	PDB
low complexity region	176	192	N/A	INTRINSIC
CUT	233	319	1.3e-36	SMART
low complexity region	322	340	N/A	INTRINSIC
CUT	356	442	3.58e-39	SMART
low complexity region	451	465	N/A	INTRINSIC
low complexity region	474	492	N/A	INTRINSIC
HOX	496	559	1.06e-7	SMART
low complexity region	570	591	N/A	INTRINSIC

Meta Mutation Damage Score

0.1050

Coding Region Coverage

1x: 99.5%
3x: 98.9%
10x: 97.9%
20x: 96.6%

Validation Efficiency

100% (65/65)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DNA binding protein that specifically binds nuclear matrix attachment regions. The encoded protein is involved in transcription regulation and chromatin remodeling. Defects in this gene are associated with isolated cleft palate and mental retardation. Alternate splicing results in multiple transcript variants that encode the same protein. [provided by RefSeq, Feb 2010]
PHENOTYPE: Homozygous inactivation of this gene causes complete perinatal lethality and craniofacial anomalies, such as cleft palate, micrognathia, microcephaly, decreased tongue size, absent incisors and nasal capsule hypoplasia, and leads to short limbs and defects in osteoblast differentiation and function. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Apobr	A	C	7: 126,588,024	D89A	probably damaging	Het
Bhlhe41	C	T	6: 145,862,968		probably benign	Het
Cacna1s	G	A	1: 136,095,785	V674M	probably benign	Het
Cavin2	T	C	1: 51,289,870		probably null	Het
Cd300lb	T	C	11: 114,924,937	S106G	possibly damaging	Het
Ceacam15	A	G	7: 16,673,196	V132A	probably benign	Het
Ddi2	G	T	4: 141,684,765	Q279K	probably benign	Het
Dnah11	A	G	12: 117,883,416	V4304A	probably damaging	Het
Dnah2	C	T	11: 69,458,920	R2399Q	probably benign	Het
Dnase1l1	C	T	X: 74,277,038		probably null	Het
Epsti1	T	A	14: 77,904,650	H55Q	probably benign	Het
Flad1	T	C	3: 89,411,196	T17A	probably damaging	Het
Fzd2	C	T	11: 102,606,155	T475M	probably damaging	Het
Gemin5	C	A	11: 58,130,061	W1099L	probably damaging	Het
Gm8979	A	T	7: 106,081,848		noncoding transcript	Het
Gm9892	T	C	8: 52,196,929		noncoding transcript	Het
Gmeb2	A	G	2: 181,255,986		probably benign	Het
Grip1	A	G	10: 119,929,928	E55G	probably damaging	Het
Hltf	T	C	3: 20,108,112	S825P	probably damaging	Het
Kcnh3	A	T	15: 99,241,939	Q902L	probably null	Het
Kcnt2	C	T	1: 140,609,615	P1037L	probably damaging	Het
Klhl18	G	C	9: 110,436,127	N335K	possibly damaging	Het
Lama5	A	C	2: 180,193,801	L1253R	probably damaging	Het
Lancl2	T	G	6: 57,724,582	S230A	probably benign	Het
Lmcd1	A	G	6: 112,315,588	M134V	probably damaging	Het
Lrrc23	C	A	6: 124,774,482	A205S	probably damaging	Het
Mfsd13b	T	A	7: 120,991,738	I234N	probably damaging	Het
Mroh3	A	G	1: 136,196,323	S386P	probably damaging	Het
Mylk3	A	C	8: 85,355,431	F313V	possibly damaging	Het
Myo9b	A	T	8: 71,333,388	Q643L	possibly damaging	Het
Nacad	T	C	11: 6,605,745	S2G	unknown	Het
Olfr1269	A	T	2: 90,118,699	W300R	probably damaging	Het
Olfr136	C	T	17: 38,335,456	Q100*	probably null	Het
Olfr419	G	T	1: 174,250,756	T57K	possibly damaging	Het
Olfr908	T	C	9: 38,516,116	F28S	probably damaging	Het
Pkd1	T	C	17: 24,576,074	V2245A	probably damaging	Het
Pkdrej	G	A	15: 85,817,118	T1539I	possibly damaging	Het
Plch2	G	T	4: 154,989,999		probably null	Het
Pygm	G	A	19: 6,384,579	R34H	probably damaging	Het
Rgs12	T	C	5: 35,021,104		probably benign	Het
Ruvbl1	T	C	6: 88,485,908	I338T	probably damaging	Het
Sapcd1	T	A	17: 35,026,731	Q104L	probably damaging	Het
Sema6b	T	A	17: 56,127,091		probably null	Het
Slc25a11	T	C	11: 70,646,185	N15D	probably damaging	Het
Slc26a6	C	T	9: 108,860,646	T526M	probably damaging	Het
Tcaf3	G	T	6: 42,587,510	T906K	possibly damaging	Het
Thbd	A	T	2: 148,406,983	C322S	probably damaging	Het
Traf2	A	G	2: 25,520,440	L399P	probably damaging	Het
Troap	T	A	15: 99,078,817	V274D	probably damaging	Het
Utrn	G	A	10: 12,401,355	T3406M	probably damaging	Het
Uts2	G	T	4: 150,999,051	A40S	possibly damaging	Het
Vmn2r109	T	A	17: 20,554,341	I251F	possibly damaging	Het
Vmn2r67	A	G	7: 85,137,022	S592P	probably damaging	Het
Vps13b	T	G	15: 35,876,413	W2797G	probably damaging	Het
Ythdf1	A	T	2: 180,912,188	M51K	probably damaging	Het
Zfp60	T	A	7: 27,738,530		probably benign	Het
Zfp882	T	A	8: 71,914,360	F344I	probably damaging	Het

Other mutations in Satb2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00742:Satb2	APN	1	56831541	missense	possibly damaging	0.56
IGL02008:Satb2	APN	1	56796793	missense	possibly damaging	0.70
IGL02209:Satb2	APN	1	56871518	missense	probably damaging	1.00
IGL02956:Satb2	APN	1	56948175	missense	probably damaging	0.99
IGL03214:Satb2	APN	1	56845580	missense	probably damaging	1.00
IGL03272:Satb2	APN	1	56845643	missense	probably damaging	1.00
IGL03356:Satb2	APN	1	56891174	missense	probably damaging	1.00
Optimism	UTSW	1	56845721	nonsense	probably null
prophecy	UTSW	1	56845619	missense	probably damaging	1.00
R0990:Satb2	UTSW	1	56850184	missense	probably damaging	0.96
R1534:Satb2	UTSW	1	56948233	nonsense	probably null
R1711:Satb2	UTSW	1	56850289	missense	probably damaging	0.99
R1952:Satb2	UTSW	1	56899070	missense	probably damaging	1.00
R2404:Satb2	UTSW	1	56948108	missense	probably damaging	1.00
R3792:Satb2	UTSW	1	56845620	missense	probably damaging	1.00
R3870:Satb2	UTSW	1	56891220	missense	probably damaging	1.00
R3871:Satb2	UTSW	1	56891220	missense	probably damaging	1.00
R4333:Satb2	UTSW	1	56845586	missense	probably damaging	1.00
R4621:Satb2	UTSW	1	56845619	missense	probably damaging	1.00
R4962:Satb2	UTSW	1	56891168	missense	probably benign	0.25
R5314:Satb2	UTSW	1	56831527	missense	probably damaging	0.99
R5407:Satb2	UTSW	1	56948150	missense	probably damaging	1.00
R5925:Satb2	UTSW	1	56796938	missense	possibly damaging	0.80
R6355:Satb2	UTSW	1	56948197	missense	probably damaging	1.00
R6634:Satb2	UTSW	1	56845721	nonsense	probably null
R6645:Satb2	UTSW	1	56797007	missense	possibly damaging	0.51
R7578:Satb2	UTSW	1	56871784	missense	probably benign	0.01
R7694:Satb2	UTSW	1	56871524	missense	probably benign
R7811:Satb2	UTSW	1	56845721	missense	probably benign	0.19
R7961:Satb2	UTSW	1	56871758	missense	probably benign	0.01
R8009:Satb2	UTSW	1	56871758	missense	probably benign	0.01
R8023:Satb2	UTSW	1	56891231	missense	probably damaging	1.00
R8094:Satb2	UTSW	1	56831464	missense	possibly damaging	0.95
R8745:Satb2	UTSW	1	56969637	missense	unknown
R8960:Satb2	UTSW	1	56871311	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- AACAGAAAGTCCTTGGACCC -3'
(R):5'- TCGGTCTCGCACAAAGATCTC -3'

Sequencing Primer
(F):5'- CAGAAAGTCCTTGGACCCATCTATTG -3'
(R):5'- AAAGATCTCTTTGGAAGCCCTGG -3'

Posted On

2016-07-22