Incidental Mutation 'R5296:Satb2'
ID405386
Institutional Source Beutler Lab
Gene Symbol Satb2
Ensembl Gene ENSMUSG00000038331
Gene Namespecial AT-rich sequence binding protein 2
Synonyms
MMRRC Submission 042879-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5296 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location56793981-56978650 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 56796907 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 575 (E575G)
Ref Sequence ENSEMBL: ENSMUSP00000135391 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042857] [ENSMUST00000114415] [ENSMUST00000177424]
Predicted Effect probably damaging
Transcript: ENSMUST00000042857
AA Change: E634G

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000046067
Gene: ENSMUSG00000038331
AA Change: E634G

DomainStartEndE-ValueType
PDB:3TUO|D 45 98 8e-19 PDB
PDB:3NZL|A 106 174 4e-35 PDB
low complexity region 235 251 N/A INTRINSIC
CUT 292 378 1.3e-36 SMART
low complexity region 381 399 N/A INTRINSIC
CUT 415 501 3.58e-39 SMART
low complexity region 510 524 N/A INTRINSIC
low complexity region 533 551 N/A INTRINSIC
HOX 555 618 1.06e-7 SMART
low complexity region 629 650 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114415
AA Change: E693G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000110057
Gene: ENSMUSG00000038331
AA Change: E693G

DomainStartEndE-ValueType
Pfam:ULD 58 156 1.7e-39 PFAM
Pfam:CUTL 162 233 3.9e-46 PFAM
low complexity region 294 310 N/A INTRINSIC
CUT 351 437 1.3e-36 SMART
low complexity region 440 458 N/A INTRINSIC
CUT 474 560 3.58e-39 SMART
low complexity region 569 583 N/A INTRINSIC
low complexity region 592 610 N/A INTRINSIC
HOX 614 677 1.06e-7 SMART
low complexity region 688 709 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000177424
AA Change: E575G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000135391
Gene: ENSMUSG00000038331
AA Change: E575G

DomainStartEndE-ValueType
PDB:3TUO|D 57 115 6e-23 PDB
low complexity region 176 192 N/A INTRINSIC
CUT 233 319 1.3e-36 SMART
low complexity region 322 340 N/A INTRINSIC
CUT 356 442 3.58e-39 SMART
low complexity region 451 465 N/A INTRINSIC
low complexity region 474 492 N/A INTRINSIC
HOX 496 559 1.06e-7 SMART
low complexity region 570 591 N/A INTRINSIC
Meta Mutation Damage Score 0.1050 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.9%
  • 10x: 97.9%
  • 20x: 96.6%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DNA binding protein that specifically binds nuclear matrix attachment regions. The encoded protein is involved in transcription regulation and chromatin remodeling. Defects in this gene are associated with isolated cleft palate and mental retardation. Alternate splicing results in multiple transcript variants that encode the same protein. [provided by RefSeq, Feb 2010]
PHENOTYPE: Homozygous inactivation of this gene causes complete perinatal lethality and craniofacial anomalies, such as cleft palate, micrognathia, microcephaly, decreased tongue size, absent incisors and nasal capsule hypoplasia, and leads to short limbs and defects in osteoblast differentiation and function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apobr A C 7: 126,588,024 D89A probably damaging Het
Bhlhe41 C T 6: 145,862,968 probably benign Het
Cacna1s G A 1: 136,095,785 V674M probably benign Het
Cavin2 T C 1: 51,289,870 probably null Het
Cd300lb T C 11: 114,924,937 S106G possibly damaging Het
Ceacam15 A G 7: 16,673,196 V132A probably benign Het
Ddi2 G T 4: 141,684,765 Q279K probably benign Het
Dnah11 A G 12: 117,883,416 V4304A probably damaging Het
Dnah2 C T 11: 69,458,920 R2399Q probably benign Het
Dnase1l1 C T X: 74,277,038 probably null Het
Epsti1 T A 14: 77,904,650 H55Q probably benign Het
Flad1 T C 3: 89,411,196 T17A probably damaging Het
Fzd2 C T 11: 102,606,155 T475M probably damaging Het
Gemin5 C A 11: 58,130,061 W1099L probably damaging Het
Gm8979 A T 7: 106,081,848 noncoding transcript Het
Gm9892 T C 8: 52,196,929 noncoding transcript Het
Gmeb2 A G 2: 181,255,986 probably benign Het
Grip1 A G 10: 119,929,928 E55G probably damaging Het
Hltf T C 3: 20,108,112 S825P probably damaging Het
Kcnh3 A T 15: 99,241,939 Q902L probably null Het
Kcnt2 C T 1: 140,609,615 P1037L probably damaging Het
Klhl18 G C 9: 110,436,127 N335K possibly damaging Het
Lama5 A C 2: 180,193,801 L1253R probably damaging Het
Lancl2 T G 6: 57,724,582 S230A probably benign Het
Lmcd1 A G 6: 112,315,588 M134V probably damaging Het
Lrrc23 C A 6: 124,774,482 A205S probably damaging Het
Mfsd13b T A 7: 120,991,738 I234N probably damaging Het
Mroh3 A G 1: 136,196,323 S386P probably damaging Het
Mylk3 A C 8: 85,355,431 F313V possibly damaging Het
Myo9b A T 8: 71,333,388 Q643L possibly damaging Het
Nacad T C 11: 6,605,745 S2G unknown Het
Olfr1269 A T 2: 90,118,699 W300R probably damaging Het
Olfr136 C T 17: 38,335,456 Q100* probably null Het
Olfr419 G T 1: 174,250,756 T57K possibly damaging Het
Olfr908 T C 9: 38,516,116 F28S probably damaging Het
Pkd1 T C 17: 24,576,074 V2245A probably damaging Het
Pkdrej G A 15: 85,817,118 T1539I possibly damaging Het
Plch2 G T 4: 154,989,999 probably null Het
Pygm G A 19: 6,384,579 R34H probably damaging Het
Rgs12 T C 5: 35,021,104 probably benign Het
Ruvbl1 T C 6: 88,485,908 I338T probably damaging Het
Sapcd1 T A 17: 35,026,731 Q104L probably damaging Het
Sema6b T A 17: 56,127,091 probably null Het
Slc25a11 T C 11: 70,646,185 N15D probably damaging Het
Slc26a6 C T 9: 108,860,646 T526M probably damaging Het
Tcaf3 G T 6: 42,587,510 T906K possibly damaging Het
Thbd A T 2: 148,406,983 C322S probably damaging Het
Traf2 A G 2: 25,520,440 L399P probably damaging Het
Troap T A 15: 99,078,817 V274D probably damaging Het
Utrn G A 10: 12,401,355 T3406M probably damaging Het
Uts2 G T 4: 150,999,051 A40S possibly damaging Het
Vmn2r109 T A 17: 20,554,341 I251F possibly damaging Het
Vmn2r67 A G 7: 85,137,022 S592P probably damaging Het
Vps13b T G 15: 35,876,413 W2797G probably damaging Het
Ythdf1 A T 2: 180,912,188 M51K probably damaging Het
Zfp60 T A 7: 27,738,530 probably benign Het
Zfp882 T A 8: 71,914,360 F344I probably damaging Het
Other mutations in Satb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00742:Satb2 APN 1 56831541 missense possibly damaging 0.56
IGL02008:Satb2 APN 1 56796793 missense possibly damaging 0.70
IGL02209:Satb2 APN 1 56871518 missense probably damaging 1.00
IGL02956:Satb2 APN 1 56948175 missense probably damaging 0.99
IGL03214:Satb2 APN 1 56845580 missense probably damaging 1.00
IGL03272:Satb2 APN 1 56845643 missense probably damaging 1.00
IGL03356:Satb2 APN 1 56891174 missense probably damaging 1.00
Optimism UTSW 1 56845721 nonsense probably null
prophecy UTSW 1 56845619 missense probably damaging 1.00
R0990:Satb2 UTSW 1 56850184 missense probably damaging 0.96
R1534:Satb2 UTSW 1 56948233 nonsense probably null
R1711:Satb2 UTSW 1 56850289 missense probably damaging 0.99
R1952:Satb2 UTSW 1 56899070 missense probably damaging 1.00
R2404:Satb2 UTSW 1 56948108 missense probably damaging 1.00
R3792:Satb2 UTSW 1 56845620 missense probably damaging 1.00
R3870:Satb2 UTSW 1 56891220 missense probably damaging 1.00
R3871:Satb2 UTSW 1 56891220 missense probably damaging 1.00
R4333:Satb2 UTSW 1 56845586 missense probably damaging 1.00
R4621:Satb2 UTSW 1 56845619 missense probably damaging 1.00
R4962:Satb2 UTSW 1 56891168 missense probably benign 0.25
R5314:Satb2 UTSW 1 56831527 missense probably damaging 0.99
R5407:Satb2 UTSW 1 56948150 missense probably damaging 1.00
R5925:Satb2 UTSW 1 56796938 missense possibly damaging 0.80
R6355:Satb2 UTSW 1 56948197 missense probably damaging 1.00
R6634:Satb2 UTSW 1 56845721 nonsense probably null
R6645:Satb2 UTSW 1 56797007 missense possibly damaging 0.51
R7578:Satb2 UTSW 1 56871784 missense probably benign 0.01
R7694:Satb2 UTSW 1 56871524 missense probably benign
R7811:Satb2 UTSW 1 56845721 missense probably benign 0.19
R7961:Satb2 UTSW 1 56871758 missense probably benign 0.01
R8009:Satb2 UTSW 1 56871758 missense probably benign 0.01
R8023:Satb2 UTSW 1 56891231 missense probably damaging 1.00
R8094:Satb2 UTSW 1 56831464 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- AACAGAAAGTCCTTGGACCC -3'
(R):5'- TCGGTCTCGCACAAAGATCTC -3'

Sequencing Primer
(F):5'- CAGAAAGTCCTTGGACCCATCTATTG -3'
(R):5'- AAAGATCTCTTTGGAAGCCCTGG -3'
Posted On2016-07-22