Mutagenetix > Incidental Mutations

Incidental Mutation 'R0497:Aph1b'

40539

Institutional Source

Beutler Lab

Gene Symbol

Aph1b

Ensembl Gene

ENSMUSG00000032375

Gene Name

aph1 homolog B, gamma secretase subunit

Synonyms

MMRRC Submission

038693-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0497 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

66775202-66795490 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

G to T at 66790618 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Stop codon at position 112 (S112*)

Ref Sequence

ENSEMBL: ENSMUSP00000125816 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034934] [ENSMUST00000113730] [ENSMUST00000168309]

Predicted Effect

probably null
Transcript: ENSMUST00000034934
AA Change: S112*

SMART Domains

Protein: ENSMUSP00000034934
Gene: ENSMUSG00000032375
AA Change: S112*

Domain	Start	End	E-Value	Type
Pfam:Aph-1	2	238	4.1e-92	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000113730
AA Change: S112*

SMART Domains

Protein: ENSMUSP00000109359
Gene: ENSMUSG00000032375
AA Change: S112*

Domain	Start	End	E-Value	Type
Pfam:Aph-1	2	119	2.7e-48	PFAM
Pfam:Aph-1	110	204	1.4e-28	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000168309
AA Change: S112*

SMART Domains

Protein: ENSMUSP00000125816
Gene: ENSMUSG00000032375
AA Change: S112*

Domain	Start	End	E-Value	Type
Pfam:Aph-1	2	172	7.8e-67	PFAM

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.6%
3x: 98.7%
10x: 96.6%
20x: 93.1%

Validation Efficiency

100% (68/68)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multi-pass transmembrane protein that is a functional component of the gamma-secretase complex, which also contains presenilin and nicastrin. This protein represents a stabilizing cofactor for the presenilin holoprotein in the complex. The gamma-secretase complex catalyzes the cleavage of integral proteins such as notch receptors and beta-amyloid precursor protein. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygous null mice are viable and fertile and do not show any significant aberrations in the brain, kidney, or testis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9530053A07Rik	T	A	7: 28,147,465	C1158S	probably damaging	Het
Aatk	A	C	11: 120,018,780	V110G	probably damaging	Het
Adcy6	A	C	15: 98,597,725		probably null	Het
Adm	A	G	7: 110,629,121	T170A	probably benign	Het
Afap1l2	G	T	19: 56,930,209	N171K	probably benign	Het
Arhgap23	A	G	11: 97,452,163	S424G	probably damaging	Het
Asah2	T	A	19: 32,054,631	N46I	probably benign	Het
Braf	G	A	6: 39,640,549		probably benign	Het
Brd2	C	T	17: 34,114,360	R47Q	probably damaging	Het
C2cd5	A	G	6: 143,012,093	V972A	probably benign	Het
Car9	T	A	4: 43,511,881	L300H	probably damaging	Het
Chmp3	T	C	6: 71,552,411	S20P	probably damaging	Het
Chp1	A	G	2: 119,571,782	N79S	possibly damaging	Het
Cnot2	A	T	10: 116,498,355	I335N	probably damaging	Het
Cntnap4	T	C	8: 112,570,151	V6A	probably benign	Het
Ctcf	T	A	8: 105,675,040		probably benign	Het
Dennd1b	A	G	1: 139,039,986		probably benign	Het
Dirc2	A	T	16: 35,735,604	V162D	probably benign	Het
Dnmbp	A	G	19: 43,856,640		probably benign	Het
Eef2	T	C	10: 81,181,586	F782L	probably benign	Het
Eogt	T	A	6: 97,135,233	Y153F	probably benign	Het
Fam81a	G	T	9: 70,096,119	Q237K	possibly damaging	Het
Fat2	T	A	11: 55,283,402	T2162S	probably benign	Het
Gas6	T	C	8: 13,470,387	I434V	possibly damaging	Het
Gm42417	A	T	1: 36,532,167	L77Q	probably damaging	Het
Grik3	A	T	4: 125,623,510	N49Y	possibly damaging	Het
Gucy2e	A	T	11: 69,224,159	V974E	probably damaging	Het
Helz2	A	G	2: 181,229,656	V2721A	probably damaging	Het
Klhl6	GT	G	16: 19,956,966		probably null	Het
Krt73	A	G	15: 101,802,230	L23P	probably damaging	Het
L3mbtl3	T	C	10: 26,282,874		probably benign	Het
Lrrc15	A	T	16: 30,272,892	V543E	probably damaging	Het
Med13	G	A	11: 86,276,983		probably benign	Het
Med25	T	C	7: 44,892,100	D60G	probably damaging	Het
Mgam	T	A	6: 40,664,892	Y560N	probably damaging	Het
Mlkl	A	G	8: 111,327,873	Y211H	probably damaging	Het
Msl2	A	G	9: 101,101,294	N289S	probably benign	Het
Nwd2	G	T	5: 63,806,343	W1090L	probably damaging	Het
Olfr1281	A	G	2: 111,328,830	D137G	probably benign	Het
Omt2b	T	C	9: 78,328,231		probably benign	Het
Pald1	A	G	10: 61,341,315	L652P	probably damaging	Het
Pard3b	T	A	1: 62,440,008		probably null	Het
Prdm15	G	A	16: 97,794,334	T1098I	possibly damaging	Het
Rock2	A	G	12: 16,954,953	T436A	probably benign	Het
Sema4c	A	T	1: 36,549,608	D812E	probably benign	Het
Sla	A	T	15: 66,792,249	I91K	probably benign	Het
Slc22a16	T	G	10: 40,584,967	M255R	probably damaging	Het
Smg8	C	T	11: 87,086,084	D224N	possibly damaging	Het
Spdef	A	T	17: 27,718,058	D190E	probably benign	Het
Taok1	A	G	11: 77,573,804	I152T	probably damaging	Het
Tmem220	A	G	11: 67,025,922	D36G	probably damaging	Het
Tmem235	A	C	11: 117,864,351	I210L	probably benign	Het
Tmem266	C	T	9: 55,380,884		probably null	Het
Tmprss12	A	G	15: 100,281,039		probably benign	Het
Trim32	G	A	4: 65,613,254	R16Q	probably damaging	Het
Usp38	T	A	8: 80,984,424		probably benign	Het
Usp44	C	T	10: 93,846,806	P373S	possibly damaging	Het
Vmn1r209	G	T	13: 22,805,948	Q191K	probably damaging	Het
Vmn1r70	T	C	7: 10,634,026	I147T	probably benign	Het
Vmn2r107	T	A	17: 20,375,132	I649N	probably damaging	Het
Vmn2r12	A	T	5: 109,091,889	Y269*	probably null	Het
Zan	C	T	5: 137,412,676		probably benign	Het
Zfp616	G	T	11: 74,083,480	V192L	probably benign	Het
Zfp644	A	T	5: 106,638,333	V116D	probably damaging	Het
Zgrf1	T	C	3: 127,584,650		probably benign	Het
Zhx3	A	T	2: 160,779,994	L751*	probably null	Het
Znfx1	T	A	2: 167,055,411	Q531L	probably benign	Het

Other mutations in Aph1b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02313:Aph1b	APN	9	66790673	splice site	probably benign
R0621:Aph1b	UTSW	9	66779334	missense	possibly damaging	0.94
R1253:Aph1b	UTSW	9	66790649	nonsense	probably null
R1864:Aph1b	UTSW	9	66794113	missense	probably benign	0.05
R2221:Aph1b	UTSW	9	66784639	missense	probably damaging	1.00
R2223:Aph1b	UTSW	9	66784639	missense	probably damaging	1.00
R3788:Aph1b	UTSW	9	66794066	splice site	probably benign
R4874:Aph1b	UTSW	9	66790596	critical splice donor site	probably null
R7497:Aph1b	UTSW	9	66794119	missense	probably damaging	0.98
R7652:Aph1b	UTSW	9	66784541	missense	probably benign	0.09
R8217:Aph1b	UTSW	9	66779272	missense	possibly damaging	0.75
R8420:Aph1b	UTSW	9	66794221	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTCTGGAAGGCTACGTGAGAAAGTG -3'
(R):5'- TGACTTAAATGGACTCTGGACTGAGCA -3'

Sequencing Primer
(F):5'- actggtgcctgcgtgag -3'
(R):5'- ACTCTGGACTGAGCATGTAGC -3'

Posted On

2013-05-23