Incidental Mutation 'R5296:Traf2'
ID 405392
Institutional Source Beutler Lab
Gene Symbol Traf2
Ensembl Gene ENSMUSG00000026942
Gene Name TNF receptor-associated factor 2
Synonyms
MMRRC Submission 042879-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5296 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 25517982-25546940 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 25520440 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 399 (L399P)
Ref Sequence ENSEMBL: ENSMUSP00000109872 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028311] [ENSMUST00000114234]
AlphaFold P39429
Predicted Effect probably damaging
Transcript: ENSMUST00000028311
AA Change: L392P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028311
Gene: ENSMUSG00000026942
AA Change: L392P

DomainStartEndE-ValueType
RING 34 72 3.19e-3 SMART
Pfam:zf-TRAF 178 235 1.9e-22 PFAM
MATH 356 478 3.09e-19 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000114234
AA Change: L399P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109872
Gene: ENSMUSG00000026942
AA Change: L399P

DomainStartEndE-ValueType
RING 34 79 3.42e-2 SMART
Pfam:zf-TRAF 185 242 2.4e-23 PFAM
Pfam:TRAF_BIRC3_bd 274 337 1.6e-34 PFAM
MATH 363 485 3.09e-19 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151742
Meta Mutation Damage Score 0.9289 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.9%
  • 10x: 97.9%
  • 20x: 96.6%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the TNF receptor associated factor (TRAF) protein family. TRAF proteins associate with, and mediate the signal transduction from members of the TNF receptor superfamily. This protein directly interacts with TNF receptors, and forms a heterodimeric complex with TRAF1. This protein is required for TNF-alpha-mediated activation of MAPK8/JNK and NF-kappaB. The protein complex formed by this protein and TRAF1 interacts with the inhibitor-of-apoptosis proteins (IAPs), and functions as a mediator of the anti-apoptotic signals from TNF receptors. The interaction of this protein with TRADD, a TNF receptor associated apoptotic signal transducer, ensures the recruitment of IAPs for the direct inhibition of caspase activation. BIRC2/c-IAP1, an apoptosis inhibitor possessing ubiquitin ligase activity, can unbiquitinate and induce the degradation of this protein, and thus potentiate TNF-induced apoptosis. Multiple alternatively spliced transcript variants have been found for this gene, but the biological validity of only one transcript has been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Increased lethaltiy is observed with homozygous null mice. Offspring are runted and exhibit atrophic thymii and spleens with reduced numbers of lymphocytes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apobr A C 7: 126,588,024 D89A probably damaging Het
Bhlhe41 C T 6: 145,862,968 probably benign Het
Cacna1s G A 1: 136,095,785 V674M probably benign Het
Cavin2 T C 1: 51,289,870 probably null Het
Cd300lb T C 11: 114,924,937 S106G possibly damaging Het
Ceacam15 A G 7: 16,673,196 V132A probably benign Het
Ddi2 G T 4: 141,684,765 Q279K probably benign Het
Dnah11 A G 12: 117,883,416 V4304A probably damaging Het
Dnah2 C T 11: 69,458,920 R2399Q probably benign Het
Dnase1l1 C T X: 74,277,038 probably null Het
Epsti1 T A 14: 77,904,650 H55Q probably benign Het
Flad1 T C 3: 89,411,196 T17A probably damaging Het
Fzd2 C T 11: 102,606,155 T475M probably damaging Het
Gemin5 C A 11: 58,130,061 W1099L probably damaging Het
Gm8979 A T 7: 106,081,848 noncoding transcript Het
Gm9892 T C 8: 52,196,929 noncoding transcript Het
Gmeb2 A G 2: 181,255,986 probably benign Het
Grip1 A G 10: 119,929,928 E55G probably damaging Het
Hltf T C 3: 20,108,112 S825P probably damaging Het
Kcnh3 A T 15: 99,241,939 Q902L probably null Het
Kcnt2 C T 1: 140,609,615 P1037L probably damaging Het
Klhl18 G C 9: 110,436,127 N335K possibly damaging Het
Lama5 A C 2: 180,193,801 L1253R probably damaging Het
Lancl2 T G 6: 57,724,582 S230A probably benign Het
Lmcd1 A G 6: 112,315,588 M134V probably damaging Het
Lrrc23 C A 6: 124,774,482 A205S probably damaging Het
Mfsd13b T A 7: 120,991,738 I234N probably damaging Het
Mroh3 A G 1: 136,196,323 S386P probably damaging Het
Mylk3 A C 8: 85,355,431 F313V possibly damaging Het
Myo9b A T 8: 71,333,388 Q643L possibly damaging Het
Nacad T C 11: 6,605,745 S2G unknown Het
Olfr1269 A T 2: 90,118,699 W300R probably damaging Het
Olfr136 C T 17: 38,335,456 Q100* probably null Het
Olfr419 G T 1: 174,250,756 T57K possibly damaging Het
Olfr908 T C 9: 38,516,116 F28S probably damaging Het
Pkd1 T C 17: 24,576,074 V2245A probably damaging Het
Pkdrej G A 15: 85,817,118 T1539I possibly damaging Het
Plch2 G T 4: 154,989,999 probably null Het
Pygm G A 19: 6,384,579 R34H probably damaging Het
Rgs12 T C 5: 35,021,104 probably benign Het
Ruvbl1 T C 6: 88,485,908 I338T probably damaging Het
Sapcd1 T A 17: 35,026,731 Q104L probably damaging Het
Satb2 T C 1: 56,796,907 E575G probably damaging Het
Sema6b T A 17: 56,127,091 probably null Het
Slc25a11 T C 11: 70,646,185 N15D probably damaging Het
Slc26a6 C T 9: 108,860,646 T526M probably damaging Het
Tcaf3 G T 6: 42,587,510 T906K possibly damaging Het
Thbd A T 2: 148,406,983 C322S probably damaging Het
Troap T A 15: 99,078,817 V274D probably damaging Het
Utrn G A 10: 12,401,355 T3406M probably damaging Het
Uts2 G T 4: 150,999,051 A40S possibly damaging Het
Vmn2r109 T A 17: 20,554,341 I251F possibly damaging Het
Vmn2r67 A G 7: 85,137,022 S592P probably damaging Het
Vps13b T G 15: 35,876,413 W2797G probably damaging Het
Ythdf1 A T 2: 180,912,188 M51K probably damaging Het
Zfp60 T A 7: 27,738,530 probably benign Het
Zfp882 T A 8: 71,914,360 F344I probably damaging Het
Other mutations in Traf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00156:Traf2 APN 2 25520451 nonsense probably null
IGL01010:Traf2 APN 2 25520438 nonsense probably null
IGL01063:Traf2 APN 2 25524919 missense probably benign 0.00
IGL01146:Traf2 APN 2 25524919 missense probably benign 0.00
IGL02114:Traf2 APN 2 25524992 missense possibly damaging 0.50
IGL02319:Traf2 APN 2 25536683 missense probably damaging 0.99
accessory UTSW 2 25537088 frame shift probably null
infinitum UTSW 2 25520446 missense probably damaging 1.00
parallel UTSW 2 25530415 missense probably benign 0.02
R0116:Traf2 UTSW 2 25519609 missense probably damaging 1.00
R0238:Traf2 UTSW 2 25537126 missense possibly damaging 0.90
R0238:Traf2 UTSW 2 25537126 missense possibly damaging 0.90
R1741:Traf2 UTSW 2 25524483 missense probably damaging 1.00
R3605:Traf2 UTSW 2 25530415 missense probably benign 0.02
R3607:Traf2 UTSW 2 25530415 missense probably benign 0.02
R4940:Traf2 UTSW 2 25530288 missense probably null 0.48
R5784:Traf2 UTSW 2 25539037 missense probably benign 0.32
R7536:Traf2 UTSW 2 25537106 missense possibly damaging 0.63
R7639:Traf2 UTSW 2 25537088 frame shift probably null
R8684:Traf2 UTSW 2 25520446 missense probably damaging 1.00
R9650:Traf2 UTSW 2 25520442 missense probably damaging 1.00
Z1176:Traf2 UTSW 2 25537144 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CGGCACTGAGAAATAATCACTGC -3'
(R):5'- TGTTTCTTTTGTGAGGAAACCC -3'

Sequencing Primer
(F):5'- GCATGGATTCATACAGCGTC -3'
(R):5'- GTGAGGAAACCCTTTTCTTGATAC -3'
Posted On 2016-07-22