Incidental Mutation 'R5296:Olfr1269'
ID405393
Institutional Source Beutler Lab
Gene Symbol Olfr1269
Ensembl Gene ENSMUSG00000084336
Gene Nameolfactory receptor 1269
SynonymsGA_x6K02T2Q125-51551618-51550689, MOR228-3
MMRRC Submission 042879-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.372) question?
Stock #R5296 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location90116187-90121412 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 90118699 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 300 (W300R)
Ref Sequence ENSEMBL: ENSMUSP00000150470 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099756] [ENSMUST00000117787] [ENSMUST00000214404] [ENSMUST00000216493]
Predicted Effect probably damaging
Transcript: ENSMUST00000099756
AA Change: W300R

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000097345
Gene: ENSMUSG00000084336
AA Change: W300R

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 3.8e-50 PFAM
Pfam:7TM_GPCR_Srsx 33 300 1.2e-5 PFAM
Pfam:7tm_1 39 285 5.9e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000117787
Predicted Effect probably damaging
Transcript: ENSMUST00000214404
AA Change: W300R

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000216493
AA Change: W300R

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
Meta Mutation Damage Score 0.3539 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.9%
  • 10x: 97.9%
  • 20x: 96.6%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apobr A C 7: 126,588,024 D89A probably damaging Het
Bhlhe41 C T 6: 145,862,968 probably benign Het
Cacna1s G A 1: 136,095,785 V674M probably benign Het
Cavin2 T C 1: 51,289,870 probably null Het
Cd300lb T C 11: 114,924,937 S106G possibly damaging Het
Ceacam15 A G 7: 16,673,196 V132A probably benign Het
Ddi2 G T 4: 141,684,765 Q279K probably benign Het
Dnah11 A G 12: 117,883,416 V4304A probably damaging Het
Dnah2 C T 11: 69,458,920 R2399Q probably benign Het
Dnase1l1 C T X: 74,277,038 probably null Het
Epsti1 T A 14: 77,904,650 H55Q probably benign Het
Flad1 T C 3: 89,411,196 T17A probably damaging Het
Fzd2 C T 11: 102,606,155 T475M probably damaging Het
Gemin5 C A 11: 58,130,061 W1099L probably damaging Het
Gm8979 A T 7: 106,081,848 noncoding transcript Het
Gm9892 T C 8: 52,196,929 noncoding transcript Het
Gmeb2 A G 2: 181,255,986 probably benign Het
Grip1 A G 10: 119,929,928 E55G probably damaging Het
Hltf T C 3: 20,108,112 S825P probably damaging Het
Kcnh3 A T 15: 99,241,939 Q902L probably null Het
Kcnt2 C T 1: 140,609,615 P1037L probably damaging Het
Klhl18 G C 9: 110,436,127 N335K possibly damaging Het
Lama5 A C 2: 180,193,801 L1253R probably damaging Het
Lancl2 T G 6: 57,724,582 S230A probably benign Het
Lmcd1 A G 6: 112,315,588 M134V probably damaging Het
Lrrc23 C A 6: 124,774,482 A205S probably damaging Het
Mfsd13b T A 7: 120,991,738 I234N probably damaging Het
Mroh3 A G 1: 136,196,323 S386P probably damaging Het
Mylk3 A C 8: 85,355,431 F313V possibly damaging Het
Myo9b A T 8: 71,333,388 Q643L possibly damaging Het
Nacad T C 11: 6,605,745 S2G unknown Het
Olfr136 C T 17: 38,335,456 Q100* probably null Het
Olfr419 G T 1: 174,250,756 T57K possibly damaging Het
Olfr908 T C 9: 38,516,116 F28S probably damaging Het
Pkd1 T C 17: 24,576,074 V2245A probably damaging Het
Pkdrej G A 15: 85,817,118 T1539I possibly damaging Het
Plch2 G T 4: 154,989,999 probably null Het
Pygm G A 19: 6,384,579 R34H probably damaging Het
Rgs12 T C 5: 35,021,104 probably benign Het
Ruvbl1 T C 6: 88,485,908 I338T probably damaging Het
Sapcd1 T A 17: 35,026,731 Q104L probably damaging Het
Satb2 T C 1: 56,796,907 E575G probably damaging Het
Sema6b T A 17: 56,127,091 probably null Het
Slc25a11 T C 11: 70,646,185 N15D probably damaging Het
Slc26a6 C T 9: 108,860,646 T526M probably damaging Het
Tcaf3 G T 6: 42,587,510 T906K possibly damaging Het
Thbd A T 2: 148,406,983 C322S probably damaging Het
Traf2 A G 2: 25,520,440 L399P probably damaging Het
Troap T A 15: 99,078,817 V274D probably damaging Het
Utrn G A 10: 12,401,355 T3406M probably damaging Het
Uts2 G T 4: 150,999,051 A40S possibly damaging Het
Vmn2r109 T A 17: 20,554,341 I251F possibly damaging Het
Vmn2r67 A G 7: 85,137,022 S592P probably damaging Het
Vps13b T G 15: 35,876,413 W2797G probably damaging Het
Ythdf1 A T 2: 180,912,188 M51K probably damaging Het
Zfp60 T A 7: 27,738,530 probably benign Het
Zfp882 T A 8: 71,914,360 F344I probably damaging Het
Other mutations in Olfr1269
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01389:Olfr1269 APN 2 90119068 missense probably damaging 1.00
IGL01518:Olfr1269 APN 2 90118971 missense possibly damaging 0.95
IGL01889:Olfr1269 APN 2 90118965 missense possibly damaging 0.84
IGL02629:Olfr1269 APN 2 90118857 nonsense probably null
R0732:Olfr1269 UTSW 2 90119322 missense probably benign 0.20
R1446:Olfr1269 UTSW 2 90118858 missense probably damaging 0.98
R1938:Olfr1269 UTSW 2 90119083 missense probably damaging 0.97
R4526:Olfr1269 UTSW 2 90118672 missense probably benign 0.01
R4786:Olfr1269 UTSW 2 90119007 missense possibly damaging 0.95
R4792:Olfr1269 UTSW 2 90118830 missense possibly damaging 0.95
R4925:Olfr1269 UTSW 2 90118777 missense probably damaging 1.00
R5152:Olfr1269 UTSW 2 90119121 missense probably damaging 0.98
R5450:Olfr1269 UTSW 2 90118669 makesense probably null
R5536:Olfr1269 UTSW 2 90118839 missense probably benign 0.00
R7572:Olfr1269 UTSW 2 90118743 missense probably damaging 1.00
R7695:Olfr1269 UTSW 2 90118863 missense probably benign 0.08
R7879:Olfr1269 UTSW 2 90118841 nonsense probably null
R7938:Olfr1269 UTSW 2 90118829 nonsense probably null
R8280:Olfr1269 UTSW 2 90119398 missense probably benign 0.27
Predicted Primers PCR Primer
(F):5'- TCTATCAGGAGTGCATTTGTAAGAC -3'
(R):5'- ATCCCATGTCACTGTGGTTATATTG -3'

Sequencing Primer
(F):5'- TTCTGCTGTAAATACTTGCTACAG -3'
(R):5'- ATATTGTTCTTTGGTCCATGTGTC -3'
Posted On2016-07-22