Incidental Mutation 'R5296:Ythdf1'
ID405397
Institutional Source Beutler Lab
Gene Symbol Ythdf1
Ensembl Gene ENSMUSG00000038848
Gene NameYTH domain family 1
Synonyms
MMRRC Submission 042879-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5296 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location180904377-180920949 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 180912188 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 51 (M51K)
Ref Sequence ENSEMBL: ENSMUSP00000037808 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037299] [ENSMUST00000108876] [ENSMUST00000124666]
Predicted Effect probably damaging
Transcript: ENSMUST00000037299
AA Change: M51K

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000037808
Gene: ENSMUSG00000038848
AA Change: M51K

DomainStartEndE-ValueType
low complexity region 47 63 N/A INTRINSIC
low complexity region 133 153 N/A INTRINSIC
low complexity region 279 326 N/A INTRINSIC
Pfam:YTH 388 526 4.2e-51 PFAM
low complexity region 540 557 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108876
AA Change: M78K

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000104504
Gene: ENSMUSG00000038848
AA Change: M78K

DomainStartEndE-ValueType
low complexity region 74 90 N/A INTRINSIC
low complexity region 160 180 N/A INTRINSIC
low complexity region 306 353 N/A INTRINSIC
Pfam:YTH 416 551 1.9e-46 PFAM
low complexity region 567 584 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000124666
AA Change: M44K

PolyPhen 2 Score 0.764 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000116665
Gene: ENSMUSG00000038848
AA Change: M44K

DomainStartEndE-ValueType
low complexity region 40 56 N/A INTRINSIC
low complexity region 126 146 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.9%
  • 10x: 97.9%
  • 20x: 96.6%
Validation Efficiency 100% (65/65)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apobr A C 7: 126,588,024 D89A probably damaging Het
Bhlhe41 C T 6: 145,862,968 probably benign Het
Cacna1s G A 1: 136,095,785 V674M probably benign Het
Cavin2 T C 1: 51,289,870 probably null Het
Cd300lb T C 11: 114,924,937 S106G possibly damaging Het
Ceacam15 A G 7: 16,673,196 V132A probably benign Het
Ddi2 G T 4: 141,684,765 Q279K probably benign Het
Dnah11 A G 12: 117,883,416 V4304A probably damaging Het
Dnah2 C T 11: 69,458,920 R2399Q probably benign Het
Dnase1l1 C T X: 74,277,038 probably null Het
Epsti1 T A 14: 77,904,650 H55Q probably benign Het
Flad1 T C 3: 89,411,196 T17A probably damaging Het
Fzd2 C T 11: 102,606,155 T475M probably damaging Het
Gemin5 C A 11: 58,130,061 W1099L probably damaging Het
Gm8979 A T 7: 106,081,848 noncoding transcript Het
Gm9892 T C 8: 52,196,929 noncoding transcript Het
Gmeb2 A G 2: 181,255,986 probably benign Het
Grip1 A G 10: 119,929,928 E55G probably damaging Het
Hltf T C 3: 20,108,112 S825P probably damaging Het
Kcnh3 A T 15: 99,241,939 Q902L probably null Het
Kcnt2 C T 1: 140,609,615 P1037L probably damaging Het
Klhl18 G C 9: 110,436,127 N335K possibly damaging Het
Lama5 A C 2: 180,193,801 L1253R probably damaging Het
Lancl2 T G 6: 57,724,582 S230A probably benign Het
Lmcd1 A G 6: 112,315,588 M134V probably damaging Het
Lrrc23 C A 6: 124,774,482 A205S probably damaging Het
Mfsd13b T A 7: 120,991,738 I234N probably damaging Het
Mroh3 A G 1: 136,196,323 S386P probably damaging Het
Mylk3 A C 8: 85,355,431 F313V possibly damaging Het
Myo9b A T 8: 71,333,388 Q643L possibly damaging Het
Nacad T C 11: 6,605,745 S2G unknown Het
Olfr1269 A T 2: 90,118,699 W300R probably damaging Het
Olfr136 C T 17: 38,335,456 Q100* probably null Het
Olfr419 G T 1: 174,250,756 T57K possibly damaging Het
Olfr908 T C 9: 38,516,116 F28S probably damaging Het
Pkd1 T C 17: 24,576,074 V2245A probably damaging Het
Pkdrej G A 15: 85,817,118 T1539I possibly damaging Het
Plch2 G T 4: 154,989,999 probably null Het
Pygm G A 19: 6,384,579 R34H probably damaging Het
Rgs12 T C 5: 35,021,104 probably benign Het
Ruvbl1 T C 6: 88,485,908 I338T probably damaging Het
Sapcd1 T A 17: 35,026,731 Q104L probably damaging Het
Satb2 T C 1: 56,796,907 E575G probably damaging Het
Sema6b T A 17: 56,127,091 probably null Het
Slc25a11 T C 11: 70,646,185 N15D probably damaging Het
Slc26a6 C T 9: 108,860,646 T526M probably damaging Het
Tcaf3 G T 6: 42,587,510 T906K possibly damaging Het
Thbd A T 2: 148,406,983 C322S probably damaging Het
Traf2 A G 2: 25,520,440 L399P probably damaging Het
Troap T A 15: 99,078,817 V274D probably damaging Het
Utrn G A 10: 12,401,355 T3406M probably damaging Het
Uts2 G T 4: 150,999,051 A40S possibly damaging Het
Vmn2r109 T A 17: 20,554,341 I251F possibly damaging Het
Vmn2r67 A G 7: 85,137,022 S592P probably damaging Het
Vps13b T G 15: 35,876,413 W2797G probably damaging Het
Zfp60 T A 7: 27,738,530 probably benign Het
Zfp882 T A 8: 71,914,360 F344I probably damaging Het
Other mutations in Ythdf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01787:Ythdf1 APN 2 180911693 missense probably damaging 0.99
IGL03066:Ythdf1 APN 2 180911546 missense probably damaging 1.00
Agitated UTSW 2 180919133 critical splice donor site probably null
R1258:Ythdf1 UTSW 2 180911310 missense probably benign 0.05
R1541:Ythdf1 UTSW 2 180919143 missense probably damaging 1.00
R1738:Ythdf1 UTSW 2 180911492 missense probably benign 0.00
R1856:Ythdf1 UTSW 2 180910970 missense probably damaging 1.00
R2169:Ythdf1 UTSW 2 180912114 missense probably damaging 1.00
R4606:Ythdf1 UTSW 2 180912182 missense probably damaging 0.97
R6250:Ythdf1 UTSW 2 180911100 missense probably damaging 1.00
R6254:Ythdf1 UTSW 2 180911150 missense probably damaging 1.00
R6702:Ythdf1 UTSW 2 180919133 critical splice donor site probably null
R7102:Ythdf1 UTSW 2 180911522 missense probably damaging 1.00
R7409:Ythdf1 UTSW 2 180911993 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATGTTGTTCCCCAGACCC -3'
(R):5'- TGTGCTTTGAGACAGCAGTC -3'

Sequencing Primer
(F):5'- TTCCCCAGACCCCCAGG -3'
(R):5'- ACAGCAGTCTGGTTTGCATTTGTTAC -3'
Posted On2016-07-22