Incidental Mutation 'R5296:Gmeb2'
ID405398
Institutional Source Beutler Lab
Gene Symbol Gmeb2
Ensembl Gene ENSMUSG00000038705
Gene Nameglucocorticoid modulatory element binding protein 2
Synonyms
MMRRC Submission 042879-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.194) question?
Stock #R5296 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location181251449-181288035 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to G at 181255986 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000115853 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049032] [ENSMUST00000130475] [ENSMUST00000141003] [ENSMUST00000141110]
Predicted Effect probably benign
Transcript: ENSMUST00000049032
SMART Domains Protein: ENSMUSP00000037075
Gene: ENSMUSG00000038705

DomainStartEndE-ValueType
low complexity region 6 18 N/A INTRINSIC
SAND 90 163 1.66e-42 SMART
coiled coil region 304 347 N/A INTRINSIC
low complexity region 414 426 N/A INTRINSIC
low complexity region 475 488 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123148
Predicted Effect probably benign
Transcript: ENSMUST00000130475
SMART Domains Protein: ENSMUSP00000116479
Gene: ENSMUSG00000038705

DomainStartEndE-ValueType
low complexity region 6 18 N/A INTRINSIC
SAND 90 163 1.66e-42 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000141003
SMART Domains Protein: ENSMUSP00000116854
Gene: ENSMUSG00000038705

DomainStartEndE-ValueType
low complexity region 6 18 N/A INTRINSIC
Pfam:SAND 81 126 7.9e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000141110
SMART Domains Protein: ENSMUSP00000115853
Gene: ENSMUSG00000038705

DomainStartEndE-ValueType
low complexity region 6 18 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.9%
  • 10x: 97.9%
  • 20x: 96.6%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of KDWK gene family. The product of this gene associates with GMEB1 protein, and the complex is essential for parvovirus DNA replication. Study of rat homolog implicates the role of this gene in modulation of transactivation by the glucocorticoid receptor bound to glucocorticoid response elements. This gene appears to use multiple polyadenylation sites. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apobr A C 7: 126,588,024 D89A probably damaging Het
Bhlhe41 C T 6: 145,862,968 probably benign Het
Cacna1s G A 1: 136,095,785 V674M probably benign Het
Cavin2 T C 1: 51,289,870 probably null Het
Cd300lb T C 11: 114,924,937 S106G possibly damaging Het
Ceacam15 A G 7: 16,673,196 V132A probably benign Het
Ddi2 G T 4: 141,684,765 Q279K probably benign Het
Dnah11 A G 12: 117,883,416 V4304A probably damaging Het
Dnah2 C T 11: 69,458,920 R2399Q probably benign Het
Dnase1l1 C T X: 74,277,038 probably null Het
Epsti1 T A 14: 77,904,650 H55Q probably benign Het
Flad1 T C 3: 89,411,196 T17A probably damaging Het
Fzd2 C T 11: 102,606,155 T475M probably damaging Het
Gemin5 C A 11: 58,130,061 W1099L probably damaging Het
Gm8979 A T 7: 106,081,848 noncoding transcript Het
Gm9892 T C 8: 52,196,929 noncoding transcript Het
Grip1 A G 10: 119,929,928 E55G probably damaging Het
Hltf T C 3: 20,108,112 S825P probably damaging Het
Kcnh3 A T 15: 99,241,939 Q902L probably null Het
Kcnt2 C T 1: 140,609,615 P1037L probably damaging Het
Klhl18 G C 9: 110,436,127 N335K possibly damaging Het
Lama5 A C 2: 180,193,801 L1253R probably damaging Het
Lancl2 T G 6: 57,724,582 S230A probably benign Het
Lmcd1 A G 6: 112,315,588 M134V probably damaging Het
Lrrc23 C A 6: 124,774,482 A205S probably damaging Het
Mfsd13b T A 7: 120,991,738 I234N probably damaging Het
Mroh3 A G 1: 136,196,323 S386P probably damaging Het
Mylk3 A C 8: 85,355,431 F313V possibly damaging Het
Myo9b A T 8: 71,333,388 Q643L possibly damaging Het
Nacad T C 11: 6,605,745 S2G unknown Het
Olfr1269 A T 2: 90,118,699 W300R probably damaging Het
Olfr136 C T 17: 38,335,456 Q100* probably null Het
Olfr419 G T 1: 174,250,756 T57K possibly damaging Het
Olfr908 T C 9: 38,516,116 F28S probably damaging Het
Pkd1 T C 17: 24,576,074 V2245A probably damaging Het
Pkdrej G A 15: 85,817,118 T1539I possibly damaging Het
Plch2 G T 4: 154,989,999 probably null Het
Pygm G A 19: 6,384,579 R34H probably damaging Het
Rgs12 T C 5: 35,021,104 probably benign Het
Ruvbl1 T C 6: 88,485,908 I338T probably damaging Het
Sapcd1 T A 17: 35,026,731 Q104L probably damaging Het
Satb2 T C 1: 56,796,907 E575G probably damaging Het
Sema6b T A 17: 56,127,091 probably null Het
Slc25a11 T C 11: 70,646,185 N15D probably damaging Het
Slc26a6 C T 9: 108,860,646 T526M probably damaging Het
Tcaf3 G T 6: 42,587,510 T906K possibly damaging Het
Thbd A T 2: 148,406,983 C322S probably damaging Het
Traf2 A G 2: 25,520,440 L399P probably damaging Het
Troap T A 15: 99,078,817 V274D probably damaging Het
Utrn G A 10: 12,401,355 T3406M probably damaging Het
Uts2 G T 4: 150,999,051 A40S possibly damaging Het
Vmn2r109 T A 17: 20,554,341 I251F possibly damaging Het
Vmn2r67 A G 7: 85,137,022 S592P probably damaging Het
Vps13b T G 15: 35,876,413 W2797G probably damaging Het
Ythdf1 A T 2: 180,912,188 M51K probably damaging Het
Zfp60 T A 7: 27,738,530 probably benign Het
Zfp882 T A 8: 71,914,360 F344I probably damaging Het
Other mutations in Gmeb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00978:Gmeb2 APN 2 181259043 missense probably benign 0.18
IGL02882:Gmeb2 APN 2 181265883 missense probably damaging 0.98
R0437:Gmeb2 UTSW 2 181253973 missense possibly damaging 0.83
R1499:Gmeb2 UTSW 2 181255226 missense probably benign 0.01
R2064:Gmeb2 UTSW 2 181253970 missense probably benign 0.42
R2127:Gmeb2 UTSW 2 181259049 missense probably benign 0.21
R2517:Gmeb2 UTSW 2 181259026 missense probably benign 0.12
R3087:Gmeb2 UTSW 2 181255640 splice site probably benign
R4202:Gmeb2 UTSW 2 181253973 missense possibly damaging 0.83
R4470:Gmeb2 UTSW 2 181265145 intron probably null
R4936:Gmeb2 UTSW 2 181254246 missense probably benign 0.04
R5402:Gmeb2 UTSW 2 181255957 splice site probably null
R5708:Gmeb2 UTSW 2 181264989 missense probably damaging 1.00
R5934:Gmeb2 UTSW 2 181255574 missense possibly damaging 0.63
R7673:Gmeb2 UTSW 2 181260388 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TAGATAGTTCCAGCCACGGG -3'
(R):5'- AGCAAAATGTTGGGAGCTGC -3'

Sequencing Primer
(F):5'- GGCCCACCCATAATCCTGAG -3'
(R):5'- CTGCTGAAGTTGAATGATAGCTCAG -3'
Posted On2016-07-22