Mutagenetix > Incidental Mutation

Incidental Mutation 'R5296:Hltf'

405399

Institutional Source

Beutler Lab

Gene Symbol

Hltf

Ensembl Gene

ENSMUSG00000002428

Gene Name

helicase-like transcription factor

Synonyms

P113, Snf2l3, Smarca3

MMRRC Submission

042879-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5296 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

20057811-20118490 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 20108112 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 825 (S825P)

Ref Sequence

ENSEMBL: ENSMUSP00000002502 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000002502] [ENSMUST00000143005] [ENSMUST00000145853]

AlphaFold

Q6PCN7

Predicted Effect

probably damaging
Transcript: ENSMUST00000002502
AA Change: S825P

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000002502
Gene: ENSMUSG00000002428
AA Change: S825P

Domain	Start	End	E-Value	Type
HIRAN	60	154	3.78e-29	SMART
DEXDc	236	608	1.26e-32	SMART
RING	754	794	4.41e-6	SMART
low complexity region	814	828	N/A	INTRINSIC
HELICc	859	944	2.24e-15	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128127

Predicted Effect

probably benign
Transcript: ENSMUST00000143005

SMART Domains

Protein: ENSMUSP00000116570
Gene: ENSMUSG00000002428

Domain	Start	End	E-Value	Type
HIRAN	60	154	3.78e-29	SMART
DEXDc	236	610	2.36e-23	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000145853

SMART Domains

Protein: ENSMUSP00000118775
Gene: ENSMUSG00000002428

Domain	Start	End	E-Value	Type
HIRAN	1	92	2.7e-25	SMART
DEXDc	174	548	2.36e-23	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155635

Meta Mutation Damage Score

0.2986

Coding Region Coverage

1x: 99.5%
3x: 98.9%
10x: 97.9%
20x: 96.6%

Validation Efficiency

100% (65/65)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SWI/SNF family. Members of this family have helicase and ATPase activities and are thought to regulate transcription of certain genes by altering the chromatin structure around those genes. The encoded protein contains a RING finger DNA binding motif. Two transcript variants encoding the same protein have been found for this gene. However, use of an alternative translation start site produces an isoform that is truncated at the N-terminus compared to the full-length protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit neonatal lethality, spongiform encephalopathy with increased brain apoptosis, and hypoglycemia. Mice homozygous for a different knock-out allele fail to show fluoxetine-induced neurogenesis and behavioral responses. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Apobr	A	C	7: 126,588,024	D89A	probably damaging	Het
Bhlhe41	C	T	6: 145,862,968		probably benign	Het
Cacna1s	G	A	1: 136,095,785	V674M	probably benign	Het
Cavin2	T	C	1: 51,289,870		probably null	Het
Cd300lb	T	C	11: 114,924,937	S106G	possibly damaging	Het
Ceacam15	A	G	7: 16,673,196	V132A	probably benign	Het
Ddi2	G	T	4: 141,684,765	Q279K	probably benign	Het
Dnah11	A	G	12: 117,883,416	V4304A	probably damaging	Het
Dnah2	C	T	11: 69,458,920	R2399Q	probably benign	Het
Dnase1l1	C	T	X: 74,277,038		probably null	Het
Epsti1	T	A	14: 77,904,650	H55Q	probably benign	Het
Flad1	T	C	3: 89,411,196	T17A	probably damaging	Het
Fzd2	C	T	11: 102,606,155	T475M	probably damaging	Het
Gemin5	C	A	11: 58,130,061	W1099L	probably damaging	Het
Gm8979	A	T	7: 106,081,848		noncoding transcript	Het
Gm9892	T	C	8: 52,196,929		noncoding transcript	Het
Gmeb2	A	G	2: 181,255,986		probably benign	Het
Grip1	A	G	10: 119,929,928	E55G	probably damaging	Het
Kcnh3	A	T	15: 99,241,939	Q902L	probably null	Het
Kcnt2	C	T	1: 140,609,615	P1037L	probably damaging	Het
Klhl18	G	C	9: 110,436,127	N335K	possibly damaging	Het
Lama5	A	C	2: 180,193,801	L1253R	probably damaging	Het
Lancl2	T	G	6: 57,724,582	S230A	probably benign	Het
Lmcd1	A	G	6: 112,315,588	M134V	probably damaging	Het
Lrrc23	C	A	6: 124,774,482	A205S	probably damaging	Het
Mfsd13b	T	A	7: 120,991,738	I234N	probably damaging	Het
Mroh3	A	G	1: 136,196,323	S386P	probably damaging	Het
Mylk3	A	C	8: 85,355,431	F313V	possibly damaging	Het
Myo9b	A	T	8: 71,333,388	Q643L	possibly damaging	Het
Nacad	T	C	11: 6,605,745	S2G	unknown	Het
Olfr1269	A	T	2: 90,118,699	W300R	probably damaging	Het
Olfr136	C	T	17: 38,335,456	Q100*	probably null	Het
Olfr419	G	T	1: 174,250,756	T57K	possibly damaging	Het
Olfr908	T	C	9: 38,516,116	F28S	probably damaging	Het
Pkd1	T	C	17: 24,576,074	V2245A	probably damaging	Het
Pkdrej	G	A	15: 85,817,118	T1539I	possibly damaging	Het
Plch2	G	T	4: 154,989,999		probably null	Het
Pygm	G	A	19: 6,384,579	R34H	probably damaging	Het
Rgs12	T	C	5: 35,021,104		probably benign	Het
Ruvbl1	T	C	6: 88,485,908	I338T	probably damaging	Het
Sapcd1	T	A	17: 35,026,731	Q104L	probably damaging	Het
Satb2	T	C	1: 56,796,907	E575G	probably damaging	Het
Sema6b	T	A	17: 56,127,091		probably null	Het
Slc25a11	T	C	11: 70,646,185	N15D	probably damaging	Het
Slc26a6	C	T	9: 108,860,646	T526M	probably damaging	Het
Tcaf3	G	T	6: 42,587,510	T906K	possibly damaging	Het
Thbd	A	T	2: 148,406,983	C322S	probably damaging	Het
Traf2	A	G	2: 25,520,440	L399P	probably damaging	Het
Troap	T	A	15: 99,078,817	V274D	probably damaging	Het
Utrn	G	A	10: 12,401,355	T3406M	probably damaging	Het
Uts2	G	T	4: 150,999,051	A40S	possibly damaging	Het
Vmn2r109	T	A	17: 20,554,341	I251F	possibly damaging	Het
Vmn2r67	A	G	7: 85,137,022	S592P	probably damaging	Het
Vps13b	T	G	15: 35,876,413	W2797G	probably damaging	Het
Ythdf1	A	T	2: 180,912,188	M51K	probably damaging	Het
Zfp60	T	A	7: 27,738,530		probably benign	Het
Zfp882	T	A	8: 71,914,360	F344I	probably damaging	Het

Other mutations in Hltf

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00650:Hltf	APN	3	20105632	splice site	probably benign
IGL01461:Hltf	APN	3	20099939	nonsense	probably null
IGL01630:Hltf	APN	3	20082904	splice site	probably benign
IGL01704:Hltf	APN	3	20083746	splice site	probably benign
IGL02059:Hltf	APN	3	20106457	missense	probably benign
IGL02105:Hltf	APN	3	20092757	missense	probably damaging	1.00
IGL02156:Hltf	APN	3	20092807	missense	possibly damaging	0.61
IGL02870:Hltf	APN	3	20099873	missense	probably damaging	0.98
IGL02899:Hltf	APN	3	20099817	missense	probably damaging	1.00
IGL02935:Hltf	APN	3	20069051	missense	probably damaging	1.00
IGL02950:Hltf	APN	3	20076572	missense	probably benign	0.07
IGL03082:Hltf	APN	3	20064559	splice site	probably benign
snarky	UTSW	3	20109487	critical splice donor site	probably null
R0068:Hltf	UTSW	3	20059090	missense	probably damaging	1.00
R0787:Hltf	UTSW	3	20106446	missense	probably damaging	1.00
R0905:Hltf	UTSW	3	20108869	critical splice donor site	probably null
R0980:Hltf	UTSW	3	20091501	missense	probably benign	0.00
R1741:Hltf	UTSW	3	20086188	missense	probably damaging	1.00
R1748:Hltf	UTSW	3	20076521	missense	probably benign	0.13
R1799:Hltf	UTSW	3	20105691	missense	probably damaging	1.00
R1976:Hltf	UTSW	3	20106446	missense	probably damaging	1.00
R2171:Hltf	UTSW	3	20059081	missense	probably damaging	1.00
R2395:Hltf	UTSW	3	20092742	missense	probably benign	0.41
R2444:Hltf	UTSW	3	20063907	missense	possibly damaging	0.66
R3789:Hltf	UTSW	3	20069047	missense	probably damaging	1.00
R3943:Hltf	UTSW	3	20092744	missense	probably damaging	1.00
R4719:Hltf	UTSW	3	20064701	critical splice donor site	probably null
R4793:Hltf	UTSW	3	20063950	missense	possibly damaging	0.79
R5449:Hltf	UTSW	3	20069083	missense	possibly damaging	0.92
R5492:Hltf	UTSW	3	20098067	splice site	probably null
R6012:Hltf	UTSW	3	20058934	missense	probably damaging	1.00
R6157:Hltf	UTSW	3	20076496	missense	probably benign	0.13
R6254:Hltf	UTSW	3	20063829	missense	possibly damaging	0.85
R6553:Hltf	UTSW	3	20072394	missense	probably damaging	0.96
R6616:Hltf	UTSW	3	20109487	critical splice donor site	probably null
R6696:Hltf	UTSW	3	20065306	splice site	probably null
R6761:Hltf	UTSW	3	20083832	critical splice donor site	probably null
R6781:Hltf	UTSW	3	20098166	missense	probably benign	0.00
R7241:Hltf	UTSW	3	20065392	missense	probably benign	0.07
R7356:Hltf	UTSW	3	20109370	missense	probably damaging	1.00
R7453:Hltf	UTSW	3	20082752	missense	possibly damaging	0.81
R7765:Hltf	UTSW	3	20091483	missense	probably benign	0.02
R7978:Hltf	UTSW	3	20092804	missense	probably damaging	1.00
R8299:Hltf	UTSW	3	20082822	missense	possibly damaging	0.73
R8547:Hltf	UTSW	3	20098127	missense	probably damaging	1.00
R8857:Hltf	UTSW	3	20105661	missense	probably damaging	0.98
R8859:Hltf	UTSW	3	20065402	nonsense	probably null
R8926:Hltf	UTSW	3	20069159	critical splice donor site	probably null
R8959:Hltf	UTSW	3	20082772	missense	probably damaging	1.00
R9052:Hltf	UTSW	3	20098082	missense	probably damaging	1.00
R9214:Hltf	UTSW	3	20086116	missense	probably benign	0.01
R9405:Hltf	UTSW	3	20082930	missense	possibly damaging	0.88
R9565:Hltf	UTSW	3	20082832	critical splice donor site	probably null
X0027:Hltf	UTSW	3	20067389	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- TTCAGGTACAGGTTGATCTCAAG -3'
(R):5'- GCAGGACTCATTGAACAAATCTCC -3'

Sequencing Primer
(F):5'- GGTACAGGTTGATCTCAAGTAAATG -3'
(R):5'- CTGGAACTCACTTTGTAGACCAGG -3'

Posted On

2016-07-22