Incidental Mutation 'R5296:Hltf'
ID405399
Institutional Source Beutler Lab
Gene Symbol Hltf
Ensembl Gene ENSMUSG00000002428
Gene Namehelicase-like transcription factor
SynonymsP113, Snf2l3, Smarca3
MMRRC Submission 042879-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5296 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location20057811-20118490 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 20108112 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 825 (S825P)
Ref Sequence ENSEMBL: ENSMUSP00000002502 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002502] [ENSMUST00000143005] [ENSMUST00000145853]
Predicted Effect probably damaging
Transcript: ENSMUST00000002502
AA Change: S825P

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000002502
Gene: ENSMUSG00000002428
AA Change: S825P

DomainStartEndE-ValueType
HIRAN 60 154 3.78e-29 SMART
DEXDc 236 608 1.26e-32 SMART
RING 754 794 4.41e-6 SMART
low complexity region 814 828 N/A INTRINSIC
HELICc 859 944 2.24e-15 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128127
Predicted Effect probably benign
Transcript: ENSMUST00000143005
SMART Domains Protein: ENSMUSP00000116570
Gene: ENSMUSG00000002428

DomainStartEndE-ValueType
HIRAN 60 154 3.78e-29 SMART
DEXDc 236 610 2.36e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000145853
SMART Domains Protein: ENSMUSP00000118775
Gene: ENSMUSG00000002428

DomainStartEndE-ValueType
HIRAN 1 92 2.7e-25 SMART
DEXDc 174 548 2.36e-23 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155635
Meta Mutation Damage Score 0.2986 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.9%
  • 10x: 97.9%
  • 20x: 96.6%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SWI/SNF family. Members of this family have helicase and ATPase activities and are thought to regulate transcription of certain genes by altering the chromatin structure around those genes. The encoded protein contains a RING finger DNA binding motif. Two transcript variants encoding the same protein have been found for this gene. However, use of an alternative translation start site produces an isoform that is truncated at the N-terminus compared to the full-length protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit neonatal lethality, spongiform encephalopathy with increased brain apoptosis, and hypoglycemia. Mice homozygous for a different knock-out allele fail to show fluoxetine-induced neurogenesis and behavioral responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apobr A C 7: 126,588,024 D89A probably damaging Het
Bhlhe41 C T 6: 145,862,968 probably benign Het
Cacna1s G A 1: 136,095,785 V674M probably benign Het
Cavin2 T C 1: 51,289,870 probably null Het
Cd300lb T C 11: 114,924,937 S106G possibly damaging Het
Ceacam15 A G 7: 16,673,196 V132A probably benign Het
Ddi2 G T 4: 141,684,765 Q279K probably benign Het
Dnah11 A G 12: 117,883,416 V4304A probably damaging Het
Dnah2 C T 11: 69,458,920 R2399Q probably benign Het
Dnase1l1 C T X: 74,277,038 probably null Het
Epsti1 T A 14: 77,904,650 H55Q probably benign Het
Flad1 T C 3: 89,411,196 T17A probably damaging Het
Fzd2 C T 11: 102,606,155 T475M probably damaging Het
Gemin5 C A 11: 58,130,061 W1099L probably damaging Het
Gm8979 A T 7: 106,081,848 noncoding transcript Het
Gm9892 T C 8: 52,196,929 noncoding transcript Het
Gmeb2 A G 2: 181,255,986 probably benign Het
Grip1 A G 10: 119,929,928 E55G probably damaging Het
Kcnh3 A T 15: 99,241,939 Q902L probably null Het
Kcnt2 C T 1: 140,609,615 P1037L probably damaging Het
Klhl18 G C 9: 110,436,127 N335K possibly damaging Het
Lama5 A C 2: 180,193,801 L1253R probably damaging Het
Lancl2 T G 6: 57,724,582 S230A probably benign Het
Lmcd1 A G 6: 112,315,588 M134V probably damaging Het
Lrrc23 C A 6: 124,774,482 A205S probably damaging Het
Mfsd13b T A 7: 120,991,738 I234N probably damaging Het
Mroh3 A G 1: 136,196,323 S386P probably damaging Het
Mylk3 A C 8: 85,355,431 F313V possibly damaging Het
Myo9b A T 8: 71,333,388 Q643L possibly damaging Het
Nacad T C 11: 6,605,745 S2G unknown Het
Olfr1269 A T 2: 90,118,699 W300R probably damaging Het
Olfr136 C T 17: 38,335,456 Q100* probably null Het
Olfr419 G T 1: 174,250,756 T57K possibly damaging Het
Olfr908 T C 9: 38,516,116 F28S probably damaging Het
Pkd1 T C 17: 24,576,074 V2245A probably damaging Het
Pkdrej G A 15: 85,817,118 T1539I possibly damaging Het
Plch2 G T 4: 154,989,999 probably null Het
Pygm G A 19: 6,384,579 R34H probably damaging Het
Rgs12 T C 5: 35,021,104 probably benign Het
Ruvbl1 T C 6: 88,485,908 I338T probably damaging Het
Sapcd1 T A 17: 35,026,731 Q104L probably damaging Het
Satb2 T C 1: 56,796,907 E575G probably damaging Het
Sema6b T A 17: 56,127,091 probably null Het
Slc25a11 T C 11: 70,646,185 N15D probably damaging Het
Slc26a6 C T 9: 108,860,646 T526M probably damaging Het
Tcaf3 G T 6: 42,587,510 T906K possibly damaging Het
Thbd A T 2: 148,406,983 C322S probably damaging Het
Traf2 A G 2: 25,520,440 L399P probably damaging Het
Troap T A 15: 99,078,817 V274D probably damaging Het
Utrn G A 10: 12,401,355 T3406M probably damaging Het
Uts2 G T 4: 150,999,051 A40S possibly damaging Het
Vmn2r109 T A 17: 20,554,341 I251F possibly damaging Het
Vmn2r67 A G 7: 85,137,022 S592P probably damaging Het
Vps13b T G 15: 35,876,413 W2797G probably damaging Het
Ythdf1 A T 2: 180,912,188 M51K probably damaging Het
Zfp60 T A 7: 27,738,530 probably benign Het
Zfp882 T A 8: 71,914,360 F344I probably damaging Het
Other mutations in Hltf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00650:Hltf APN 3 20105632 splice site probably benign
IGL01461:Hltf APN 3 20099939 nonsense probably null
IGL01630:Hltf APN 3 20082904 splice site probably benign
IGL01704:Hltf APN 3 20083746 splice site probably benign
IGL02059:Hltf APN 3 20106457 missense probably benign
IGL02105:Hltf APN 3 20092757 missense probably damaging 1.00
IGL02156:Hltf APN 3 20092807 missense possibly damaging 0.61
IGL02870:Hltf APN 3 20099873 missense probably damaging 0.98
IGL02899:Hltf APN 3 20099817 missense probably damaging 1.00
IGL02935:Hltf APN 3 20069051 missense probably damaging 1.00
IGL02950:Hltf APN 3 20076572 missense probably benign 0.07
IGL03082:Hltf APN 3 20064559 splice site probably benign
snarky UTSW 3 20109487 critical splice donor site probably null
R0068:Hltf UTSW 3 20059090 missense probably damaging 1.00
R0787:Hltf UTSW 3 20106446 missense probably damaging 1.00
R0905:Hltf UTSW 3 20108869 critical splice donor site probably null
R0980:Hltf UTSW 3 20091501 missense probably benign 0.00
R1741:Hltf UTSW 3 20086188 missense probably damaging 1.00
R1748:Hltf UTSW 3 20076521 missense probably benign 0.13
R1799:Hltf UTSW 3 20105691 missense probably damaging 1.00
R1976:Hltf UTSW 3 20106446 missense probably damaging 1.00
R2171:Hltf UTSW 3 20059081 missense probably damaging 1.00
R2395:Hltf UTSW 3 20092742 missense probably benign 0.41
R2444:Hltf UTSW 3 20063907 missense possibly damaging 0.66
R3789:Hltf UTSW 3 20069047 missense probably damaging 1.00
R3943:Hltf UTSW 3 20092744 missense probably damaging 1.00
R4719:Hltf UTSW 3 20064701 critical splice donor site probably null
R4793:Hltf UTSW 3 20063950 missense possibly damaging 0.79
R5449:Hltf UTSW 3 20069083 missense possibly damaging 0.92
R5492:Hltf UTSW 3 20098067 splice site probably null
R6012:Hltf UTSW 3 20058934 missense probably damaging 1.00
R6157:Hltf UTSW 3 20076496 missense probably benign 0.13
R6254:Hltf UTSW 3 20063829 missense possibly damaging 0.85
R6553:Hltf UTSW 3 20072394 missense probably damaging 0.96
R6616:Hltf UTSW 3 20109487 critical splice donor site probably null
R6696:Hltf UTSW 3 20065306 splice site probably null
R6761:Hltf UTSW 3 20083832 critical splice donor site probably null
R6781:Hltf UTSW 3 20098166 missense probably benign 0.00
R7241:Hltf UTSW 3 20065392 missense probably benign 0.07
R7356:Hltf UTSW 3 20109370 missense probably damaging 1.00
R7453:Hltf UTSW 3 20082752 missense possibly damaging 0.81
R7765:Hltf UTSW 3 20091483 missense probably benign 0.02
R7978:Hltf UTSW 3 20092804 missense probably damaging 1.00
R8299:Hltf UTSW 3 20082822 missense possibly damaging 0.73
X0027:Hltf UTSW 3 20067389 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TTCAGGTACAGGTTGATCTCAAG -3'
(R):5'- GCAGGACTCATTGAACAAATCTCC -3'

Sequencing Primer
(F):5'- GGTACAGGTTGATCTCAAGTAAATG -3'
(R):5'- CTGGAACTCACTTTGTAGACCAGG -3'
Posted On2016-07-22