Mutagenetix > Incidental Mutation

Incidental Mutation 'R5296:Plch2'

405403

Institutional Source

Beutler Lab

Gene Symbol

Plch2

Ensembl Gene

ENSMUSG00000029055

Gene Name

phospholipase C, eta 2

Synonyms

Plcl4, A930027K05Rik, PLCeta2

MMRRC Submission

042879-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5296 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

154983115-155056784 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

G to T at 154989999 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000141152 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000105631] [ENSMUST00000135665] [ENSMUST00000139976] [ENSMUST00000176194] [ENSMUST00000186598]

AlphaFold

A2AP18

Predicted Effect

probably null
Transcript: ENSMUST00000105631
AA Change: S829*

SMART Domains

Protein: ENSMUSP00000101256
Gene: ENSMUSG00000029055
AA Change: S829*

Domain	Start	End	E-Value	Type
low complexity region	28	45	N/A	INTRINSIC
low complexity region	96	107	N/A	INTRINSIC
PH	122	231	1.8e-6	SMART
EFh	247	275	7.29e-4	SMART
EFh	283	312	4.67e-2	SMART
Pfam:EF-hand_like	317	399	1.7e-26	PFAM
PLCXc	400	545	6.76e-76	SMART
low complexity region	559	572	N/A	INTRINSIC
low complexity region	659	676	N/A	INTRINSIC
PLCYc	707	821	1.25e-56	SMART
C2	840	948	1.66e-21	SMART
low complexity region	1088	1107	N/A	INTRINSIC
low complexity region	1227	1236	N/A	INTRINSIC
low complexity region	1356	1369	N/A	INTRINSIC
low complexity region	1421	1451	N/A	INTRINSIC
low complexity region	1454	1466	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000124517

SMART Domains

Protein: ENSMUSP00000122139
Gene: ENSMUSG00000029055

Domain	Start	End	E-Value	Type
C2	1	77	1.58e-4	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127661

Predicted Effect

probably null
Transcript: ENSMUST00000135665
AA Change: S724*

SMART Domains

Protein: ENSMUSP00000118292
Gene: ENSMUSG00000029055
AA Change: S724*

Domain	Start	End	E-Value	Type
PH	17	126	1.8e-6	SMART
EFh	142	170	7.29e-4	SMART
EFh	178	207	4.67e-2	SMART
Pfam:EF-hand_like	212	294	2.8e-25	PFAM
PLCXc	295	440	6.76e-76	SMART
low complexity region	454	467	N/A	INTRINSIC
low complexity region	554	571	N/A	INTRINSIC
PLCYc	602	716	1.25e-56	SMART
C2	735	843	1.66e-21	SMART
low complexity region	983	1002	N/A	INTRINSIC
low complexity region	1122	1131	N/A	INTRINSIC
low complexity region	1251	1264	N/A	INTRINSIC
low complexity region	1316	1346	N/A	INTRINSIC
low complexity region	1349	1361	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000139976
AA Change: S829*

SMART Domains

Protein: ENSMUSP00000122704
Gene: ENSMUSG00000029055
AA Change: S829*

Domain	Start	End	E-Value	Type
low complexity region	28	45	N/A	INTRINSIC
low complexity region	96	107	N/A	INTRINSIC
PH	122	231	1.8e-6	SMART
EFh	247	275	7.29e-4	SMART
EFh	283	312	4.67e-2	SMART
Pfam:EF-hand_like	317	399	3.2e-27	PFAM
PLCXc	400	545	6.76e-76	SMART
low complexity region	559	572	N/A	INTRINSIC
low complexity region	659	676	N/A	INTRINSIC
PLCYc	707	821	1.25e-56	SMART
C2	840	948	1.66e-21	SMART
low complexity region	1087	1100	N/A	INTRINSIC
low complexity region	1166	1194	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000175982
AA Change: S577*

Predicted Effect

probably null
Transcript: ENSMUST00000176194
AA Change: S728*

SMART Domains

Protein: ENSMUSP00000134750
Gene: ENSMUSG00000029055
AA Change: S728*

Domain	Start	End	E-Value	Type
PH	21	130	1.8e-6	SMART
EFh	146	174	7.29e-4	SMART
EFh	182	211	4.67e-2	SMART
Pfam:EF-hand_like	216	298	1.6e-25	PFAM
PLCXc	299	444	6.76e-76	SMART
low complexity region	458	471	N/A	INTRINSIC
low complexity region	558	575	N/A	INTRINSIC
PLCYc	606	720	1.25e-56	SMART
C2	739	847	1.66e-21	SMART
low complexity region	986	999	N/A	INTRINSIC
low complexity region	1065	1093	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000176620

Predicted Effect

probably null
Transcript: ENSMUST00000186598

SMART Domains

Protein: ENSMUSP00000141152
Gene: ENSMUSG00000029055

Domain	Start	End	E-Value	Type
C2	79	189	5.8e-18	SMART
low complexity region	328	341	N/A	INTRINSIC
low complexity region	407	435	N/A	INTRINSIC

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.5%
3x: 98.9%
10x: 97.9%
20x: 96.6%

Validation Efficiency

100% (65/65)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] PLCH2 is a member of the PLC-eta family of the phosphoinositide-specific phospholipase C (PLC) superfamily of enzymes that cleave PtdIns(4,5) P2 to generate second messengers inositol 1,4,5-trisphosphate and diacylglycerol (Zhou et al., 2005 [PubMed 16107206]).[supplied by OMIM, Jun 2009]
PHENOTYPE: Mice homozygous for a reporter allele exhibit no apparent abnormal phenotype. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Apobr	A	C	7: 126,588,024	D89A	probably damaging	Het
Bhlhe41	C	T	6: 145,862,968		probably benign	Het
Cacna1s	G	A	1: 136,095,785	V674M	probably benign	Het
Cavin2	T	C	1: 51,289,870		probably null	Het
Cd300lb	T	C	11: 114,924,937	S106G	possibly damaging	Het
Ceacam15	A	G	7: 16,673,196	V132A	probably benign	Het
Ddi2	G	T	4: 141,684,765	Q279K	probably benign	Het
Dnah11	A	G	12: 117,883,416	V4304A	probably damaging	Het
Dnah2	C	T	11: 69,458,920	R2399Q	probably benign	Het
Dnase1l1	C	T	X: 74,277,038		probably null	Het
Epsti1	T	A	14: 77,904,650	H55Q	probably benign	Het
Flad1	T	C	3: 89,411,196	T17A	probably damaging	Het
Fzd2	C	T	11: 102,606,155	T475M	probably damaging	Het
Gemin5	C	A	11: 58,130,061	W1099L	probably damaging	Het
Gm8979	A	T	7: 106,081,848		noncoding transcript	Het
Gm9892	T	C	8: 52,196,929		noncoding transcript	Het
Gmeb2	A	G	2: 181,255,986		probably benign	Het
Grip1	A	G	10: 119,929,928	E55G	probably damaging	Het
Hltf	T	C	3: 20,108,112	S825P	probably damaging	Het
Kcnh3	A	T	15: 99,241,939	Q902L	probably null	Het
Kcnt2	C	T	1: 140,609,615	P1037L	probably damaging	Het
Klhl18	G	C	9: 110,436,127	N335K	possibly damaging	Het
Lama5	A	C	2: 180,193,801	L1253R	probably damaging	Het
Lancl2	T	G	6: 57,724,582	S230A	probably benign	Het
Lmcd1	A	G	6: 112,315,588	M134V	probably damaging	Het
Lrrc23	C	A	6: 124,774,482	A205S	probably damaging	Het
Mfsd13b	T	A	7: 120,991,738	I234N	probably damaging	Het
Mroh3	A	G	1: 136,196,323	S386P	probably damaging	Het
Mylk3	A	C	8: 85,355,431	F313V	possibly damaging	Het
Myo9b	A	T	8: 71,333,388	Q643L	possibly damaging	Het
Nacad	T	C	11: 6,605,745	S2G	unknown	Het
Olfr1269	A	T	2: 90,118,699	W300R	probably damaging	Het
Olfr136	C	T	17: 38,335,456	Q100*	probably null	Het
Olfr419	G	T	1: 174,250,756	T57K	possibly damaging	Het
Olfr908	T	C	9: 38,516,116	F28S	probably damaging	Het
Pkd1	T	C	17: 24,576,074	V2245A	probably damaging	Het
Pkdrej	G	A	15: 85,817,118	T1539I	possibly damaging	Het
Pygm	G	A	19: 6,384,579	R34H	probably damaging	Het
Rgs12	T	C	5: 35,021,104		probably benign	Het
Ruvbl1	T	C	6: 88,485,908	I338T	probably damaging	Het
Sapcd1	T	A	17: 35,026,731	Q104L	probably damaging	Het
Satb2	T	C	1: 56,796,907	E575G	probably damaging	Het
Sema6b	T	A	17: 56,127,091		probably null	Het
Slc25a11	T	C	11: 70,646,185	N15D	probably damaging	Het
Slc26a6	C	T	9: 108,860,646	T526M	probably damaging	Het
Tcaf3	G	T	6: 42,587,510	T906K	possibly damaging	Het
Thbd	A	T	2: 148,406,983	C322S	probably damaging	Het
Traf2	A	G	2: 25,520,440	L399P	probably damaging	Het
Troap	T	A	15: 99,078,817	V274D	probably damaging	Het
Utrn	G	A	10: 12,401,355	T3406M	probably damaging	Het
Uts2	G	T	4: 150,999,051	A40S	possibly damaging	Het
Vmn2r109	T	A	17: 20,554,341	I251F	possibly damaging	Het
Vmn2r67	A	G	7: 85,137,022	S592P	probably damaging	Het
Vps13b	T	G	15: 35,876,413	W2797G	probably damaging	Het
Ythdf1	A	T	2: 180,912,188	M51K	probably damaging	Het
Zfp60	T	A	7: 27,738,530		probably benign	Het
Zfp882	T	A	8: 71,914,360	F344I	probably damaging	Het

Other mutations in Plch2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00088:Plch2	APN	4	155006642	missense	probably damaging	1.00
IGL02024:Plch2	APN	4	155043138	intron	probably benign
IGL02580:Plch2	APN	4	154984764	missense	probably benign	0.03
IGL03370:Plch2	APN	4	154986914	missense	probably benign	0.18
IGL03407:Plch2	APN	4	154989798	missense	probably damaging	1.00
tolerant	UTSW	4	154984635	missense	probably benign	0.01
PIT4418001:Plch2	UTSW	4	154989503	missense	probably damaging	1.00
PIT4445001:Plch2	UTSW	4	155009026	missense	probably damaging	1.00
R0117:Plch2	UTSW	4	154985358	unclassified	probably benign
R0347:Plch2	UTSW	4	154986721	missense	possibly damaging	0.91
R0361:Plch2	UTSW	4	155006711	missense	possibly damaging	0.95
R0413:Plch2	UTSW	4	155006916	critical splice donor site	probably null
R0487:Plch2	UTSW	4	155009012	missense	probably damaging	1.00
R0514:Plch2	UTSW	4	154998886	missense	probably damaging	1.00
R0734:Plch2	UTSW	4	154996283	missense	probably damaging	1.00
R0766:Plch2	UTSW	4	154989799	missense	probably damaging	1.00
R1306:Plch2	UTSW	4	155007140	missense	probably damaging	1.00
R1312:Plch2	UTSW	4	154989799	missense	probably damaging	1.00
R1467:Plch2	UTSW	4	154983732	missense	probably benign	0.02
R1467:Plch2	UTSW	4	154983732	missense	probably benign	0.02
R1602:Plch2	UTSW	4	154984450	missense	probably damaging	0.99
R1717:Plch2	UTSW	4	154998272	missense	probably benign
R1731:Plch2	UTSW	4	155006994	missense	possibly damaging	0.83
R1769:Plch2	UTSW	4	155000083	missense	probably damaging	1.00
R1875:Plch2	UTSW	4	154998508	missense	probably damaging	1.00
R1974:Plch2	UTSW	4	154984953	missense	possibly damaging	0.77
R2031:Plch2	UTSW	4	155043027	intron	probably benign
R2050:Plch2	UTSW	4	155000818	missense	probably benign	0.00
R2061:Plch2	UTSW	4	155042841	intron	probably benign
R2073:Plch2	UTSW	4	154989909	missense	probably damaging	1.00
R2075:Plch2	UTSW	4	154989909	missense	probably damaging	1.00
R2109:Plch2	UTSW	4	154984597	missense	possibly damaging	0.92
R2126:Plch2	UTSW	4	154998999	missense	probably damaging	1.00
R2265:Plch2	UTSW	4	154993004	missense	probably benign	0.06
R2266:Plch2	UTSW	4	154993004	missense	probably benign	0.06
R2269:Plch2	UTSW	4	154993004	missense	probably benign	0.06
R2280:Plch2	UTSW	4	154984309	missense	probably damaging	1.00
R2281:Plch2	UTSW	4	154984309	missense	probably damaging	1.00
R2432:Plch2	UTSW	4	154986164	makesense	probably null
R2971:Plch2	UTSW	4	154990767	missense	probably benign	0.29
R3437:Plch2	UTSW	4	154991013	critical splice donor site	probably null
R3980:Plch2	UTSW	4	154984798	missense	probably benign	0.00
R4757:Plch2	UTSW	4	154996233	missense	possibly damaging	0.88
R4827:Plch2	UTSW	4	154991113	missense	probably damaging	1.00
R4828:Plch2	UTSW	4	154984635	missense	probably benign	0.01
R4869:Plch2	UTSW	4	154989428	missense	probably benign	0.28
R5020:Plch2	UTSW	4	155007083	missense	probably damaging	1.00
R5050:Plch2	UTSW	4	155043309	intron	probably benign
R5126:Plch2	UTSW	4	155000519	missense	probably damaging	1.00
R5237:Plch2	UTSW	4	155010794	missense	probably benign
R5274:Plch2	UTSW	4	154998954	missense	probably damaging	1.00
R5324:Plch2	UTSW	4	154984534	missense	probably benign
R5475:Plch2	UTSW	4	155000137	missense	probably damaging	1.00
R5494:Plch2	UTSW	4	154991122	missense	probably damaging	1.00
R5811:Plch2	UTSW	4	154992567	missense	possibly damaging	0.62
R6083:Plch2	UTSW	4	155000818	missense	probably benign	0.00
R6092:Plch2	UTSW	4	154984372	missense	probably benign	0.02
R6253:Plch2	UTSW	4	155007101	missense	probably damaging	1.00
R6456:Plch2	UTSW	4	154993002	missense	probably damaging	1.00
R7038:Plch2	UTSW	4	154990032	splice site	probably null
R7084:Plch2	UTSW	4	154986991	missense	probably benign	0.31
R7210:Plch2	UTSW	4	155009086	missense	probably damaging	1.00
R7216:Plch2	UTSW	4	154984228	missense	probably benign
R7264:Plch2	UTSW	4	154998967	missense	probably damaging	0.98
R7291:Plch2	UTSW	4	154998472	missense	probably damaging	1.00
R7423:Plch2	UTSW	4	154983737	missense	probably damaging	1.00
R7436:Plch2	UTSW	4	154984096	missense	probably benign	0.01
R7438:Plch2	UTSW	4	155000460	missense	probably damaging	1.00
R7594:Plch2	UTSW	4	155007027	missense	probably damaging	1.00
R7663:Plch2	UTSW	4	154991162	missense	probably damaging	0.96
R7698:Plch2	UTSW	4	155002787	missense	possibly damaging	0.95
R7844:Plch2	UTSW	4	154989465	missense	probably damaging	1.00
R7939:Plch2	UTSW	4	155002778	missense	possibly damaging	0.91
R8003:Plch2	UTSW	4	155054523	missense	unknown
R8007:Plch2	UTSW	4	155002831	missense	probably damaging	1.00
R8281:Plch2	UTSW	4	155006973	missense	probably benign	0.07
R8434:Plch2	UTSW	4	154989735	missense	probably damaging	1.00
R8504:Plch2	UTSW	4	154984395	missense	probably benign	0.31
R8516:Plch2	UTSW	4	154986307	missense	probably benign
R8558:Plch2	UTSW	4	154998934	missense	probably damaging	1.00
R8722:Plch2	UTSW	4	154985403	unclassified	probably benign
R8768:Plch2	UTSW	4	154998867	missense	probably damaging	1.00
R8787:Plch2	UTSW	4	154986418	missense	probably benign	0.00
R8826:Plch2	UTSW	4	154986683	missense	probably benign	0.00
R8955:Plch2	UTSW	4	154992566	missense	probably benign	0.00
R9032:Plch2	UTSW	4	155000519	missense	probably damaging	1.00
R9085:Plch2	UTSW	4	155000519	missense	probably damaging	1.00
R9423:Plch2	UTSW	4	154986592	missense
R9649:Plch2	UTSW	4	154984059	missense	probably benign
R9652:Plch2	UTSW	4	154998485	missense	probably benign
R9725:Plch2	UTSW	4	155000535	missense	probably damaging	1.00
R9742:Plch2	UTSW	4	154998455	missense	probably damaging	0.99
R9789:Plch2	UTSW	4	155010865	critical splice donor site	probably null
RF014:Plch2	UTSW	4	155007120	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCGATGATCTAGAGACAGGGTG -3'
(R):5'- ATGGTACGCCCTTGACATTAGC -3'

Sequencing Primer
(F):5'- TGAGGGGTGGCACTGGAATC -3'
(R):5'- TTGACATTAGCAGCCTGACC -3'

Posted On

2016-07-22