Incidental Mutation 'R5296:Plch2'
ID405403
Institutional Source Beutler Lab
Gene Symbol Plch2
Ensembl Gene ENSMUSG00000029055
Gene Namephospholipase C, eta 2
SynonymsPlcl4, A930027K05Rik, PLCeta2
MMRRC Submission 042879-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5296 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location154983115-155056784 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) G to T at 154989999 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000141152 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105631] [ENSMUST00000135665] [ENSMUST00000139976] [ENSMUST00000176194] [ENSMUST00000186598]
Predicted Effect probably null
Transcript: ENSMUST00000105631
AA Change: S829*
SMART Domains Protein: ENSMUSP00000101256
Gene: ENSMUSG00000029055
AA Change: S829*

DomainStartEndE-ValueType
low complexity region 28 45 N/A INTRINSIC
low complexity region 96 107 N/A INTRINSIC
PH 122 231 1.8e-6 SMART
EFh 247 275 7.29e-4 SMART
EFh 283 312 4.67e-2 SMART
Pfam:EF-hand_like 317 399 1.7e-26 PFAM
PLCXc 400 545 6.76e-76 SMART
low complexity region 559 572 N/A INTRINSIC
low complexity region 659 676 N/A INTRINSIC
PLCYc 707 821 1.25e-56 SMART
C2 840 948 1.66e-21 SMART
low complexity region 1088 1107 N/A INTRINSIC
low complexity region 1227 1236 N/A INTRINSIC
low complexity region 1356 1369 N/A INTRINSIC
low complexity region 1421 1451 N/A INTRINSIC
low complexity region 1454 1466 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000124517
SMART Domains Protein: ENSMUSP00000122139
Gene: ENSMUSG00000029055

DomainStartEndE-ValueType
C2 1 77 1.58e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127661
Predicted Effect probably null
Transcript: ENSMUST00000135665
AA Change: S724*
SMART Domains Protein: ENSMUSP00000118292
Gene: ENSMUSG00000029055
AA Change: S724*

DomainStartEndE-ValueType
PH 17 126 1.8e-6 SMART
EFh 142 170 7.29e-4 SMART
EFh 178 207 4.67e-2 SMART
Pfam:EF-hand_like 212 294 2.8e-25 PFAM
PLCXc 295 440 6.76e-76 SMART
low complexity region 454 467 N/A INTRINSIC
low complexity region 554 571 N/A INTRINSIC
PLCYc 602 716 1.25e-56 SMART
C2 735 843 1.66e-21 SMART
low complexity region 983 1002 N/A INTRINSIC
low complexity region 1122 1131 N/A INTRINSIC
low complexity region 1251 1264 N/A INTRINSIC
low complexity region 1316 1346 N/A INTRINSIC
low complexity region 1349 1361 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000139976
AA Change: S829*
SMART Domains Protein: ENSMUSP00000122704
Gene: ENSMUSG00000029055
AA Change: S829*

DomainStartEndE-ValueType
low complexity region 28 45 N/A INTRINSIC
low complexity region 96 107 N/A INTRINSIC
PH 122 231 1.8e-6 SMART
EFh 247 275 7.29e-4 SMART
EFh 283 312 4.67e-2 SMART
Pfam:EF-hand_like 317 399 3.2e-27 PFAM
PLCXc 400 545 6.76e-76 SMART
low complexity region 559 572 N/A INTRINSIC
low complexity region 659 676 N/A INTRINSIC
PLCYc 707 821 1.25e-56 SMART
C2 840 948 1.66e-21 SMART
low complexity region 1087 1100 N/A INTRINSIC
low complexity region 1166 1194 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000175982
AA Change: S577*
Predicted Effect probably null
Transcript: ENSMUST00000176194
AA Change: S728*
SMART Domains Protein: ENSMUSP00000134750
Gene: ENSMUSG00000029055
AA Change: S728*

DomainStartEndE-ValueType
PH 21 130 1.8e-6 SMART
EFh 146 174 7.29e-4 SMART
EFh 182 211 4.67e-2 SMART
Pfam:EF-hand_like 216 298 1.6e-25 PFAM
PLCXc 299 444 6.76e-76 SMART
low complexity region 458 471 N/A INTRINSIC
low complexity region 558 575 N/A INTRINSIC
PLCYc 606 720 1.25e-56 SMART
C2 739 847 1.66e-21 SMART
low complexity region 986 999 N/A INTRINSIC
low complexity region 1065 1093 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176620
Predicted Effect probably null
Transcript: ENSMUST00000186598
SMART Domains Protein: ENSMUSP00000141152
Gene: ENSMUSG00000029055

DomainStartEndE-ValueType
C2 79 189 5.8e-18 SMART
low complexity region 328 341 N/A INTRINSIC
low complexity region 407 435 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.9%
  • 10x: 97.9%
  • 20x: 96.6%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] PLCH2 is a member of the PLC-eta family of the phosphoinositide-specific phospholipase C (PLC) superfamily of enzymes that cleave PtdIns(4,5) P2 to generate second messengers inositol 1,4,5-trisphosphate and diacylglycerol (Zhou et al., 2005 [PubMed 16107206]).[supplied by OMIM, Jun 2009]
PHENOTYPE: Mice homozygous for a reporter allele exhibit no apparent abnormal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apobr A C 7: 126,588,024 D89A probably damaging Het
Bhlhe41 C T 6: 145,862,968 probably benign Het
Cacna1s G A 1: 136,095,785 V674M probably benign Het
Cavin2 T C 1: 51,289,870 probably null Het
Cd300lb T C 11: 114,924,937 S106G possibly damaging Het
Ceacam15 A G 7: 16,673,196 V132A probably benign Het
Ddi2 G T 4: 141,684,765 Q279K probably benign Het
Dnah11 A G 12: 117,883,416 V4304A probably damaging Het
Dnah2 C T 11: 69,458,920 R2399Q probably benign Het
Dnase1l1 C T X: 74,277,038 probably null Het
Epsti1 T A 14: 77,904,650 H55Q probably benign Het
Flad1 T C 3: 89,411,196 T17A probably damaging Het
Fzd2 C T 11: 102,606,155 T475M probably damaging Het
Gemin5 C A 11: 58,130,061 W1099L probably damaging Het
Gm8979 A T 7: 106,081,848 noncoding transcript Het
Gm9892 T C 8: 52,196,929 noncoding transcript Het
Gmeb2 A G 2: 181,255,986 probably benign Het
Grip1 A G 10: 119,929,928 E55G probably damaging Het
Hltf T C 3: 20,108,112 S825P probably damaging Het
Kcnh3 A T 15: 99,241,939 Q902L probably null Het
Kcnt2 C T 1: 140,609,615 P1037L probably damaging Het
Klhl18 G C 9: 110,436,127 N335K possibly damaging Het
Lama5 A C 2: 180,193,801 L1253R probably damaging Het
Lancl2 T G 6: 57,724,582 S230A probably benign Het
Lmcd1 A G 6: 112,315,588 M134V probably damaging Het
Lrrc23 C A 6: 124,774,482 A205S probably damaging Het
Mfsd13b T A 7: 120,991,738 I234N probably damaging Het
Mroh3 A G 1: 136,196,323 S386P probably damaging Het
Mylk3 A C 8: 85,355,431 F313V possibly damaging Het
Myo9b A T 8: 71,333,388 Q643L possibly damaging Het
Nacad T C 11: 6,605,745 S2G unknown Het
Olfr1269 A T 2: 90,118,699 W300R probably damaging Het
Olfr136 C T 17: 38,335,456 Q100* probably null Het
Olfr419 G T 1: 174,250,756 T57K possibly damaging Het
Olfr908 T C 9: 38,516,116 F28S probably damaging Het
Pkd1 T C 17: 24,576,074 V2245A probably damaging Het
Pkdrej G A 15: 85,817,118 T1539I possibly damaging Het
Pygm G A 19: 6,384,579 R34H probably damaging Het
Rgs12 T C 5: 35,021,104 probably benign Het
Ruvbl1 T C 6: 88,485,908 I338T probably damaging Het
Sapcd1 T A 17: 35,026,731 Q104L probably damaging Het
Satb2 T C 1: 56,796,907 E575G probably damaging Het
Sema6b T A 17: 56,127,091 probably null Het
Slc25a11 T C 11: 70,646,185 N15D probably damaging Het
Slc26a6 C T 9: 108,860,646 T526M probably damaging Het
Tcaf3 G T 6: 42,587,510 T906K possibly damaging Het
Thbd A T 2: 148,406,983 C322S probably damaging Het
Traf2 A G 2: 25,520,440 L399P probably damaging Het
Troap T A 15: 99,078,817 V274D probably damaging Het
Utrn G A 10: 12,401,355 T3406M probably damaging Het
Uts2 G T 4: 150,999,051 A40S possibly damaging Het
Vmn2r109 T A 17: 20,554,341 I251F possibly damaging Het
Vmn2r67 A G 7: 85,137,022 S592P probably damaging Het
Vps13b T G 15: 35,876,413 W2797G probably damaging Het
Ythdf1 A T 2: 180,912,188 M51K probably damaging Het
Zfp60 T A 7: 27,738,530 probably benign Het
Zfp882 T A 8: 71,914,360 F344I probably damaging Het
Other mutations in Plch2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Plch2 APN 4 155006642 missense probably damaging 1.00
IGL02024:Plch2 APN 4 155043138 intron probably benign
IGL02580:Plch2 APN 4 154984764 missense probably benign 0.03
IGL03370:Plch2 APN 4 154986914 missense probably benign 0.18
IGL03407:Plch2 APN 4 154989798 missense probably damaging 1.00
tolerant UTSW 4 154984635 missense probably benign 0.01
PIT4418001:Plch2 UTSW 4 154989503 missense probably damaging 1.00
PIT4445001:Plch2 UTSW 4 155009026 missense probably damaging 1.00
R0117:Plch2 UTSW 4 154985358 unclassified probably benign
R0347:Plch2 UTSW 4 154986721 missense possibly damaging 0.91
R0361:Plch2 UTSW 4 155006711 missense possibly damaging 0.95
R0413:Plch2 UTSW 4 155006916 critical splice donor site probably null
R0487:Plch2 UTSW 4 155009012 missense probably damaging 1.00
R0514:Plch2 UTSW 4 154998886 missense probably damaging 1.00
R0734:Plch2 UTSW 4 154996283 missense probably damaging 1.00
R0766:Plch2 UTSW 4 154989799 missense probably damaging 1.00
R1306:Plch2 UTSW 4 155007140 missense probably damaging 1.00
R1312:Plch2 UTSW 4 154989799 missense probably damaging 1.00
R1467:Plch2 UTSW 4 154983732 missense probably benign 0.02
R1467:Plch2 UTSW 4 154983732 missense probably benign 0.02
R1602:Plch2 UTSW 4 154984450 missense probably damaging 0.99
R1717:Plch2 UTSW 4 154998272 missense probably benign
R1731:Plch2 UTSW 4 155006994 missense possibly damaging 0.83
R1769:Plch2 UTSW 4 155000083 missense probably damaging 1.00
R1875:Plch2 UTSW 4 154998508 missense probably damaging 1.00
R1974:Plch2 UTSW 4 154984953 missense possibly damaging 0.77
R2031:Plch2 UTSW 4 155043027 intron probably benign
R2050:Plch2 UTSW 4 155000818 missense probably benign 0.00
R2061:Plch2 UTSW 4 155042841 intron probably benign
R2073:Plch2 UTSW 4 154989909 missense probably damaging 1.00
R2075:Plch2 UTSW 4 154989909 missense probably damaging 1.00
R2109:Plch2 UTSW 4 154984597 missense possibly damaging 0.92
R2126:Plch2 UTSW 4 154998999 missense probably damaging 1.00
R2265:Plch2 UTSW 4 154993004 missense probably benign 0.06
R2266:Plch2 UTSW 4 154993004 missense probably benign 0.06
R2269:Plch2 UTSW 4 154993004 missense probably benign 0.06
R2280:Plch2 UTSW 4 154984309 missense probably damaging 1.00
R2281:Plch2 UTSW 4 154984309 missense probably damaging 1.00
R2432:Plch2 UTSW 4 154986164 makesense probably null
R2971:Plch2 UTSW 4 154990767 missense probably benign 0.29
R3437:Plch2 UTSW 4 154991013 critical splice donor site probably null
R3980:Plch2 UTSW 4 154984798 missense probably benign 0.00
R4757:Plch2 UTSW 4 154996233 missense possibly damaging 0.88
R4827:Plch2 UTSW 4 154991113 missense probably damaging 1.00
R4828:Plch2 UTSW 4 154984635 missense probably benign 0.01
R4869:Plch2 UTSW 4 154989428 missense probably benign 0.28
R5020:Plch2 UTSW 4 155007083 missense probably damaging 1.00
R5050:Plch2 UTSW 4 155043309 intron probably benign
R5126:Plch2 UTSW 4 155000519 missense probably damaging 1.00
R5237:Plch2 UTSW 4 155010794 missense probably benign
R5274:Plch2 UTSW 4 154998954 missense probably damaging 1.00
R5324:Plch2 UTSW 4 154984534 missense probably benign
R5475:Plch2 UTSW 4 155000137 missense probably damaging 1.00
R5494:Plch2 UTSW 4 154991122 missense probably damaging 1.00
R5811:Plch2 UTSW 4 154992567 missense possibly damaging 0.62
R6083:Plch2 UTSW 4 155000818 missense probably benign 0.00
R6092:Plch2 UTSW 4 154984372 missense probably benign 0.02
R6253:Plch2 UTSW 4 155007101 missense probably damaging 1.00
R6456:Plch2 UTSW 4 154993002 missense probably damaging 1.00
R7038:Plch2 UTSW 4 154990032 intron probably null
R7084:Plch2 UTSW 4 154986991 missense probably benign 0.31
R7210:Plch2 UTSW 4 155009086 missense probably damaging 1.00
R7216:Plch2 UTSW 4 154984228 missense probably benign
R7264:Plch2 UTSW 4 154998967 missense probably damaging 0.98
R7291:Plch2 UTSW 4 154998472 missense probably damaging 1.00
R7423:Plch2 UTSW 4 154983737 missense probably damaging 1.00
R7436:Plch2 UTSW 4 154984096 missense probably benign 0.01
R7438:Plch2 UTSW 4 155000460 missense probably damaging 1.00
R7594:Plch2 UTSW 4 155007027 missense probably damaging 1.00
R7663:Plch2 UTSW 4 154991162 missense probably damaging 0.96
R7698:Plch2 UTSW 4 155002787 missense possibly damaging 0.95
RF014:Plch2 UTSW 4 155007120 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCGATGATCTAGAGACAGGGTG -3'
(R):5'- ATGGTACGCCCTTGACATTAGC -3'

Sequencing Primer
(F):5'- TGAGGGGTGGCACTGGAATC -3'
(R):5'- TTGACATTAGCAGCCTGACC -3'
Posted On2016-07-22