Mutagenetix > Incidental Mutations

Incidental Mutation 'R5296:Tcaf3'

405406

Institutional Source

Beutler Lab

Gene Symbol

Tcaf3

Ensembl Gene

ENSMUSG00000018656

Gene Name

TRPM8 channel-associated factor 3

Synonyms

Eapa2, Fam115e

MMRRC Submission

042879-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.052) question?

Stock #

R5296 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

42584866-42597692 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 42587510 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Lysine at position 906 (T906K)

Ref Sequence

ENSEMBL: ENSMUSP00000064060 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000069023]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000069023
AA Change: T906K

PolyPhen 2 Score 0.551 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000064060
Gene: ENSMUSG00000018656
AA Change: T906K

Domain	Start	End	E-Value	Type
internal_repeat_1	26	194	9.98e-16	PROSPERO
low complexity region	210	221	N/A	INTRINSIC
internal_repeat_1	234	402	9.98e-16	PROSPERO
low complexity region	509	518	N/A	INTRINSIC
M60-like	533	832	3.49e-130	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000151898

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.5%
3x: 98.9%
10x: 97.9%
20x: 96.6%

Validation Efficiency

100% (65/65)

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Apobr	A	C	7: 126,588,024	D89A	probably damaging	Het
Bhlhe41	C	T	6: 145,862,968		probably benign	Het
Cacna1s	G	A	1: 136,095,785	V674M	probably benign	Het
Cavin2	T	C	1: 51,289,870		probably null	Het
Cd300lb	T	C	11: 114,924,937	S106G	possibly damaging	Het
Ceacam15	A	G	7: 16,673,196	V132A	probably benign	Het
Ddi2	G	T	4: 141,684,765	Q279K	probably benign	Het
Dnah11	A	G	12: 117,883,416	V4304A	probably damaging	Het
Dnah2	C	T	11: 69,458,920	R2399Q	probably benign	Het
Dnase1l1	C	T	X: 74,277,038		probably null	Het
Epsti1	T	A	14: 77,904,650	H55Q	probably benign	Het
Flad1	T	C	3: 89,411,196	T17A	probably damaging	Het
Fzd2	C	T	11: 102,606,155	T475M	probably damaging	Het
Gemin5	C	A	11: 58,130,061	W1099L	probably damaging	Het
Gm8979	A	T	7: 106,081,848		noncoding transcript	Het
Gm9892	T	C	8: 52,196,929		noncoding transcript	Het
Gmeb2	A	G	2: 181,255,986		probably benign	Het
Grip1	A	G	10: 119,929,928	E55G	probably damaging	Het
Hltf	T	C	3: 20,108,112	S825P	probably damaging	Het
Kcnh3	A	T	15: 99,241,939	Q902L	probably null	Het
Kcnt2	C	T	1: 140,609,615	P1037L	probably damaging	Het
Klhl18	G	C	9: 110,436,127	N335K	possibly damaging	Het
Lama5	A	C	2: 180,193,801	L1253R	probably damaging	Het
Lancl2	T	G	6: 57,724,582	S230A	probably benign	Het
Lmcd1	A	G	6: 112,315,588	M134V	probably damaging	Het
Lrrc23	C	A	6: 124,774,482	A205S	probably damaging	Het
Mfsd13b	T	A	7: 120,991,738	I234N	probably damaging	Het
Mroh3	A	G	1: 136,196,323	S386P	probably damaging	Het
Mylk3	A	C	8: 85,355,431	F313V	possibly damaging	Het
Myo9b	A	T	8: 71,333,388	Q643L	possibly damaging	Het
Nacad	T	C	11: 6,605,745	S2G	unknown	Het
Olfr1269	A	T	2: 90,118,699	W300R	probably damaging	Het
Olfr136	C	T	17: 38,335,456	Q100*	probably null	Het
Olfr419	G	T	1: 174,250,756	T57K	possibly damaging	Het
Olfr908	T	C	9: 38,516,116	F28S	probably damaging	Het
Pkd1	T	C	17: 24,576,074	V2245A	probably damaging	Het
Pkdrej	G	A	15: 85,817,118	T1539I	possibly damaging	Het
Plch2	G	T	4: 154,989,999		probably null	Het
Pygm	G	A	19: 6,384,579	R34H	probably damaging	Het
Rgs12	T	C	5: 35,021,104		probably benign	Het
Ruvbl1	T	C	6: 88,485,908	I338T	probably damaging	Het
Sapcd1	T	A	17: 35,026,731	Q104L	probably damaging	Het
Satb2	T	C	1: 56,796,907	E575G	probably damaging	Het
Sema6b	T	A	17: 56,127,091		probably null	Het
Slc25a11	T	C	11: 70,646,185	N15D	probably damaging	Het
Slc26a6	C	T	9: 108,860,646	T526M	probably damaging	Het
Thbd	A	T	2: 148,406,983	C322S	probably damaging	Het
Traf2	A	G	2: 25,520,440	L399P	probably damaging	Het
Troap	T	A	15: 99,078,817	V274D	probably damaging	Het
Utrn	G	A	10: 12,401,355	T3406M	probably damaging	Het
Uts2	G	T	4: 150,999,051	A40S	possibly damaging	Het
Vmn2r109	T	A	17: 20,554,341	I251F	possibly damaging	Het
Vmn2r67	A	G	7: 85,137,022	S592P	probably damaging	Het
Vps13b	T	G	15: 35,876,413	W2797G	probably damaging	Het
Ythdf1	A	T	2: 180,912,188	M51K	probably damaging	Het
Zfp60	T	A	7: 27,738,530		probably benign	Het
Zfp882	T	A	8: 71,914,360	F344I	probably damaging	Het

Other mutations in Tcaf3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00162:Tcaf3	APN	6	42593385	missense	probably benign	0.14
IGL00931:Tcaf3	APN	6	42597228	missense	probably benign	0.16
IGL01391:Tcaf3	APN	6	42593681	missense	probably damaging	1.00
IGL01804:Tcaf3	APN	6	42597129	missense	probably damaging	1.00
IGL02272:Tcaf3	APN	6	42596660	missense	probably damaging	0.98
IGL02934:Tcaf3	APN	6	42593898	missense	probably benign	0.00
IGL03258:Tcaf3	APN	6	42589839	missense	probably damaging	1.00
defused	UTSW	6	42596933	missense	probably benign	0.03
R0116:Tcaf3	UTSW	6	42591350	missense	probably benign	0.12
R0135:Tcaf3	UTSW	6	42589758	missense	probably benign
R0357:Tcaf3	UTSW	6	42589827	missense	probably damaging	0.98
R0526:Tcaf3	UTSW	6	42589804	missense	probably damaging	1.00
R0592:Tcaf3	UTSW	6	42596843	missense	probably benign	0.16
R1185:Tcaf3	UTSW	6	42591434	missense	probably damaging	1.00
R1185:Tcaf3	UTSW	6	42591434	missense	probably damaging	1.00
R1185:Tcaf3	UTSW	6	42591434	missense	probably damaging	1.00
R1902:Tcaf3	UTSW	6	42593552	missense	possibly damaging	0.83
R1912:Tcaf3	UTSW	6	42596688	missense	possibly damaging	0.59
R2020:Tcaf3	UTSW	6	42593724	missense	possibly damaging	0.66
R2238:Tcaf3	UTSW	6	42593328	missense	probably benign	0.00
R2259:Tcaf3	UTSW	6	42591430	missense	possibly damaging	0.53
R2436:Tcaf3	UTSW	6	42593729	missense	probably damaging	1.00
R3005:Tcaf3	UTSW	6	42594044	missense	probably damaging	1.00
R3402:Tcaf3	UTSW	6	42593853	missense	probably benign	0.08
R3753:Tcaf3	UTSW	6	42589804	missense	probably damaging	1.00
R3799:Tcaf3	UTSW	6	42597080	missense	probably damaging	1.00
R4515:Tcaf3	UTSW	6	42589996	missense	probably damaging	1.00
R4640:Tcaf3	UTSW	6	42587579	missense	probably damaging	0.96
R4688:Tcaf3	UTSW	6	42593366	splice site	probably null
R4904:Tcaf3	UTSW	6	42593997	nonsense	probably null
R5030:Tcaf3	UTSW	6	42596933	missense	probably benign	0.03
R5031:Tcaf3	UTSW	6	42596933	missense	probably benign	0.03
R5045:Tcaf3	UTSW	6	42593684	missense	possibly damaging	0.55
R5105:Tcaf3	UTSW	6	42591325	missense	probably damaging	1.00
R5139:Tcaf3	UTSW	6	42596933	missense	probably benign	0.03
R5187:Tcaf3	UTSW	6	42597020	missense	possibly damaging	0.51
R5196:Tcaf3	UTSW	6	42593715	missense	probably benign	0.00
R5213:Tcaf3	UTSW	6	42591467	missense	probably damaging	1.00
R5402:Tcaf3	UTSW	6	42591926	missense	probably benign	0.12
R5425:Tcaf3	UTSW	6	42596763	missense	probably damaging	1.00
R5431:Tcaf3	UTSW	6	42597185	missense	probably damaging	1.00
R5601:Tcaf3	UTSW	6	42587528	missense	possibly damaging	0.90
R5839:Tcaf3	UTSW	6	42593849	missense	possibly damaging	0.55
R5865:Tcaf3	UTSW	6	42596697	missense	probably benign	0.07
R6005:Tcaf3	UTSW	6	42589971	missense	probably benign	0.19
R6270:Tcaf3	UTSW	6	42593791	missense	probably benign	0.00
R6341:Tcaf3	UTSW	6	42597259	missense	possibly damaging	0.55
R6344:Tcaf3	UTSW	6	42597171	missense	possibly damaging	0.48
R6521:Tcaf3	UTSW	6	42593238	missense	probably damaging	0.99
R6589:Tcaf3	UTSW	6	42594061	missense	possibly damaging	0.55
R6981:Tcaf3	UTSW	6	42597125	missense	probably damaging	1.00
R7155:Tcaf3	UTSW	6	42593891	missense	probably benign
R7185:Tcaf3	UTSW	6	42593930	missense	probably benign	0.01
R7262:Tcaf3	UTSW	6	42593801	missense	probably damaging	0.97
R7340:Tcaf3	UTSW	6	42589914	missense	probably benign	0.08
R7421:Tcaf3	UTSW	6	42596842	missense	probably benign	0.02
R7690:Tcaf3	UTSW	6	42597135	missense	probably damaging	1.00
R7850:Tcaf3	UTSW	6	42594206	splice site	probably null
R7909:Tcaf3	UTSW	6	42591964	missense	possibly damaging	0.92

Predicted Primers

PCR Primer
(F):5'- GCAAAATTTGAAAGCTGCTGTG -3'
(R):5'- TCATCCAGGTCTTTGCTGAC -3'

Sequencing Primer
(F):5'- AGCTGCTGTGTAATTTAATCTCTACC -3'
(R):5'- AGGTCTTTGCTGACTACCGAAC -3'

Posted On

2016-07-22