Incidental Mutation 'R5296:Lrrc23'
ID405410
Institutional Source Beutler Lab
Gene Symbol Lrrc23
Ensembl Gene ENSMUSG00000030125
Gene Nameleucine rich repeat containing 23
Synonyms4921537K05Rik, Lrpb7
MMRRC Submission 042879-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5296 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location124769863-124779727 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 124774482 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 205 (A205S)
Ref Sequence ENSEMBL: ENSMUSP00000108094 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004378] [ENSMUST00000032218] [ENSMUST00000112475] [ENSMUST00000112476] [ENSMUST00000128697] [ENSMUST00000147669] [ENSMUST00000149652] [ENSMUST00000151214] [ENSMUST00000156033] [ENSMUST00000204896]
Predicted Effect probably benign
Transcript: ENSMUST00000004378
SMART Domains Protein: ENSMUSP00000004378
Gene: ENSMUSG00000004267

DomainStartEndE-ValueType
Enolase_N 3 134 2.62e-93 SMART
Enolase_C 142 431 2.62e-207 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000032218
AA Change: A205S

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000032218
Gene: ENSMUSG00000030125
AA Change: A205S

DomainStartEndE-ValueType
coiled coil region 12 40 N/A INTRINSIC
Pfam:LRR_1 89 109 1.2e-2 PFAM
LRR 196 217 1.33e2 SMART
LRR 218 239 4.97e0 SMART
LRR 241 263 3.27e1 SMART
low complexity region 305 314 N/A INTRINSIC
low complexity region 323 332 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112475
AA Change: A205S

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000108094
Gene: ENSMUSG00000030125
AA Change: A205S

DomainStartEndE-ValueType
coiled coil region 12 40 N/A INTRINSIC
internal_repeat_1 90 182 7.1e-5 PROSPERO
LRR 196 217 1.33e2 SMART
LRR 218 239 4.97e0 SMART
LRR 241 263 3.27e1 SMART
low complexity region 305 314 N/A INTRINSIC
low complexity region 323 332 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112476
SMART Domains Protein: ENSMUSP00000108095
Gene: ENSMUSG00000004267

DomainStartEndE-ValueType
Enolase_N 3 118 2.39e-55 SMART
Enolase_C 71 312 9.08e-120 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000128697
SMART Domains Protein: ENSMUSP00000122362
Gene: ENSMUSG00000030125

DomainStartEndE-ValueType
coiled coil region 12 40 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132492
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147004
Predicted Effect probably benign
Transcript: ENSMUST00000147669
Predicted Effect probably benign
Transcript: ENSMUST00000149652
SMART Domains Protein: ENSMUSP00000119112
Gene: ENSMUSG00000004267

DomainStartEndE-ValueType
Enolase_N 3 134 2.62e-93 SMART
Pfam:Enolase_C 142 162 4.2e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000151214
Predicted Effect probably benign
Transcript: ENSMUST00000156033
SMART Domains Protein: ENSMUSP00000144698
Gene: ENSMUSG00000004267

DomainStartEndE-ValueType
Enolase_N 3 58 5.2e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000204896
SMART Domains Protein: ENSMUSP00000144861
Gene: ENSMUSG00000004267

DomainStartEndE-ValueType
Enolase_N 3 91 8e-52 SMART
Enolase_C 99 388 1.3e-211 SMART
Meta Mutation Damage Score 0.1492 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.9%
  • 10x: 97.9%
  • 20x: 96.6%
Validation Efficiency 100% (65/65)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apobr A C 7: 126,588,024 D89A probably damaging Het
Bhlhe41 C T 6: 145,862,968 probably benign Het
Cacna1s G A 1: 136,095,785 V674M probably benign Het
Cavin2 T C 1: 51,289,870 probably null Het
Cd300lb T C 11: 114,924,937 S106G possibly damaging Het
Ceacam15 A G 7: 16,673,196 V132A probably benign Het
Ddi2 G T 4: 141,684,765 Q279K probably benign Het
Dnah11 A G 12: 117,883,416 V4304A probably damaging Het
Dnah2 C T 11: 69,458,920 R2399Q probably benign Het
Dnase1l1 C T X: 74,277,038 probably null Het
Epsti1 T A 14: 77,904,650 H55Q probably benign Het
Flad1 T C 3: 89,411,196 T17A probably damaging Het
Fzd2 C T 11: 102,606,155 T475M probably damaging Het
Gemin5 C A 11: 58,130,061 W1099L probably damaging Het
Gm8979 A T 7: 106,081,848 noncoding transcript Het
Gm9892 T C 8: 52,196,929 noncoding transcript Het
Gmeb2 A G 2: 181,255,986 probably benign Het
Grip1 A G 10: 119,929,928 E55G probably damaging Het
Hltf T C 3: 20,108,112 S825P probably damaging Het
Kcnh3 A T 15: 99,241,939 Q902L probably null Het
Kcnt2 C T 1: 140,609,615 P1037L probably damaging Het
Klhl18 G C 9: 110,436,127 N335K possibly damaging Het
Lama5 A C 2: 180,193,801 L1253R probably damaging Het
Lancl2 T G 6: 57,724,582 S230A probably benign Het
Lmcd1 A G 6: 112,315,588 M134V probably damaging Het
Mfsd13b T A 7: 120,991,738 I234N probably damaging Het
Mroh3 A G 1: 136,196,323 S386P probably damaging Het
Mylk3 A C 8: 85,355,431 F313V possibly damaging Het
Myo9b A T 8: 71,333,388 Q643L possibly damaging Het
Nacad T C 11: 6,605,745 S2G unknown Het
Olfr1269 A T 2: 90,118,699 W300R probably damaging Het
Olfr136 C T 17: 38,335,456 Q100* probably null Het
Olfr419 G T 1: 174,250,756 T57K possibly damaging Het
Olfr908 T C 9: 38,516,116 F28S probably damaging Het
Pkd1 T C 17: 24,576,074 V2245A probably damaging Het
Pkdrej G A 15: 85,817,118 T1539I possibly damaging Het
Plch2 G T 4: 154,989,999 probably null Het
Pygm G A 19: 6,384,579 R34H probably damaging Het
Rgs12 T C 5: 35,021,104 probably benign Het
Ruvbl1 T C 6: 88,485,908 I338T probably damaging Het
Sapcd1 T A 17: 35,026,731 Q104L probably damaging Het
Satb2 T C 1: 56,796,907 E575G probably damaging Het
Sema6b T A 17: 56,127,091 probably null Het
Slc25a11 T C 11: 70,646,185 N15D probably damaging Het
Slc26a6 C T 9: 108,860,646 T526M probably damaging Het
Tcaf3 G T 6: 42,587,510 T906K possibly damaging Het
Thbd A T 2: 148,406,983 C322S probably damaging Het
Traf2 A G 2: 25,520,440 L399P probably damaging Het
Troap T A 15: 99,078,817 V274D probably damaging Het
Utrn G A 10: 12,401,355 T3406M probably damaging Het
Uts2 G T 4: 150,999,051 A40S possibly damaging Het
Vmn2r109 T A 17: 20,554,341 I251F possibly damaging Het
Vmn2r67 A G 7: 85,137,022 S592P probably damaging Het
Vps13b T G 15: 35,876,413 W2797G probably damaging Het
Ythdf1 A T 2: 180,912,188 M51K probably damaging Het
Zfp60 T A 7: 27,738,530 probably benign Het
Zfp882 T A 8: 71,914,360 F344I probably damaging Het
Other mutations in Lrrc23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Lrrc23 APN 6 124778926 missense probably damaging 1.00
IGL01123:Lrrc23 APN 6 124778819 missense probably benign 0.04
IGL02429:Lrrc23 APN 6 124778167 missense probably damaging 0.99
IGL02892:Lrrc23 APN 6 124774436 missense probably benign 0.03
R0440:Lrrc23 UTSW 6 124770704 missense probably benign 0.00
R0637:Lrrc23 UTSW 6 124778358 unclassified probably benign
R1055:Lrrc23 UTSW 6 124778151 missense probably damaging 1.00
R1125:Lrrc23 UTSW 6 124776182 missense probably benign 0.06
R1531:Lrrc23 UTSW 6 124776114 missense possibly damaging 0.91
R4156:Lrrc23 UTSW 6 124770841 nonsense probably null
R4838:Lrrc23 UTSW 6 124778189 missense probably benign 0.16
R7211:Lrrc23 UTSW 6 124778189 missense probably benign 0.16
R7426:Lrrc23 UTSW 6 124779125 missense unknown
R7488:Lrrc23 UTSW 6 124779112 missense unknown
R7583:Lrrc23 UTSW 6 124779578 start gained probably benign
R7829:Lrrc23 UTSW 6 124770748 missense probably benign 0.00
R8289:Lrrc23 UTSW 6 124778304 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAAGCTGCTCGTGGTGATG -3'
(R):5'- CATGGCATGAGGGTGAACTG -3'

Sequencing Primer
(F):5'- CTCGTGGTGATGGACGG -3'
(R):5'- GAGCTAGGGTCTAACACTGTACTC -3'
Posted On2016-07-22