Incidental Mutation 'R5296:Bhlhe41'
ID405411
Institutional Source Beutler Lab
Gene Symbol Bhlhe41
Ensembl Gene ENSMUSG00000030256
Gene Namebasic helix-loop-helix family, member e41
Synonyms6430520M22Rik, Bhlhb3, DEC2, Sharp1
MMRRC Submission 042879-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.214) question?
Stock #R5296 (G1)
Quality Score144
Status Validated
Chromosome6
Chromosomal Location145858243-145865558 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) C to T at 145862968 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000107332 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032386] [ENSMUST00000111703]
Predicted Effect unknown
Transcript: ENSMUST00000032386
AA Change: A373T
SMART Domains Protein: ENSMUSP00000032386
Gene: ENSMUSG00000030256
AA Change: A373T

DomainStartEndE-ValueType
HLH 50 105 4.4e-11 SMART
ORANGE 129 175 3.26e-15 SMART
low complexity region 179 204 N/A INTRINSIC
low complexity region 258 294 N/A INTRINSIC
low complexity region 317 331 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111703
SMART Domains Protein: ENSMUSP00000107332
Gene: ENSMUSG00000030256

DomainStartEndE-ValueType
HLH 50 105 4.4e-11 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203443
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203949
Meta Mutation Damage Score 0.0945 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.9%
  • 10x: 97.9%
  • 20x: 96.6%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: This gene encodes a basic helix-loop-helix protein expressed in various tissues. The encoded protein can interact with Arntl or compete for E-box binding sites in the promoter of Per1 and repress Clock/Arntl's transactivation of Per1. This gene is believed to be involved in the control of circadian rhythm and cell differentiation. Defects in this gene are associated with the short sleep phenotype. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Feb 2014]
PHENOTYPE: Mice homozygous for one knock-out allele exhibit delayed circadian phase. Mice homozygous for another knock-out allele exhibit impaired TH2 differentiation in response to numerous stimuli. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apobr A C 7: 126,588,024 D89A probably damaging Het
Cacna1s G A 1: 136,095,785 V674M probably benign Het
Cavin2 T C 1: 51,289,870 probably null Het
Cd300lb T C 11: 114,924,937 S106G possibly damaging Het
Ceacam15 A G 7: 16,673,196 V132A probably benign Het
Ddi2 G T 4: 141,684,765 Q279K probably benign Het
Dnah11 A G 12: 117,883,416 V4304A probably damaging Het
Dnah2 C T 11: 69,458,920 R2399Q probably benign Het
Dnase1l1 C T X: 74,277,038 probably null Het
Epsti1 T A 14: 77,904,650 H55Q probably benign Het
Flad1 T C 3: 89,411,196 T17A probably damaging Het
Fzd2 C T 11: 102,606,155 T475M probably damaging Het
Gemin5 C A 11: 58,130,061 W1099L probably damaging Het
Gm8979 A T 7: 106,081,848 noncoding transcript Het
Gm9892 T C 8: 52,196,929 noncoding transcript Het
Gmeb2 A G 2: 181,255,986 probably benign Het
Grip1 A G 10: 119,929,928 E55G probably damaging Het
Hltf T C 3: 20,108,112 S825P probably damaging Het
Kcnh3 A T 15: 99,241,939 Q902L probably null Het
Kcnt2 C T 1: 140,609,615 P1037L probably damaging Het
Klhl18 G C 9: 110,436,127 N335K possibly damaging Het
Lama5 A C 2: 180,193,801 L1253R probably damaging Het
Lancl2 T G 6: 57,724,582 S230A probably benign Het
Lmcd1 A G 6: 112,315,588 M134V probably damaging Het
Lrrc23 C A 6: 124,774,482 A205S probably damaging Het
Mfsd13b T A 7: 120,991,738 I234N probably damaging Het
Mroh3 A G 1: 136,196,323 S386P probably damaging Het
Mylk3 A C 8: 85,355,431 F313V possibly damaging Het
Myo9b A T 8: 71,333,388 Q643L possibly damaging Het
Nacad T C 11: 6,605,745 S2G unknown Het
Olfr1269 A T 2: 90,118,699 W300R probably damaging Het
Olfr136 C T 17: 38,335,456 Q100* probably null Het
Olfr419 G T 1: 174,250,756 T57K possibly damaging Het
Olfr908 T C 9: 38,516,116 F28S probably damaging Het
Pkd1 T C 17: 24,576,074 V2245A probably damaging Het
Pkdrej G A 15: 85,817,118 T1539I possibly damaging Het
Plch2 G T 4: 154,989,999 probably null Het
Pygm G A 19: 6,384,579 R34H probably damaging Het
Rgs12 T C 5: 35,021,104 probably benign Het
Ruvbl1 T C 6: 88,485,908 I338T probably damaging Het
Sapcd1 T A 17: 35,026,731 Q104L probably damaging Het
Satb2 T C 1: 56,796,907 E575G probably damaging Het
Sema6b T A 17: 56,127,091 probably null Het
Slc25a11 T C 11: 70,646,185 N15D probably damaging Het
Slc26a6 C T 9: 108,860,646 T526M probably damaging Het
Tcaf3 G T 6: 42,587,510 T906K possibly damaging Het
Thbd A T 2: 148,406,983 C322S probably damaging Het
Traf2 A G 2: 25,520,440 L399P probably damaging Het
Troap T A 15: 99,078,817 V274D probably damaging Het
Utrn G A 10: 12,401,355 T3406M probably damaging Het
Uts2 G T 4: 150,999,051 A40S possibly damaging Het
Vmn2r109 T A 17: 20,554,341 I251F possibly damaging Het
Vmn2r67 A G 7: 85,137,022 S592P probably damaging Het
Vps13b T G 15: 35,876,413 W2797G probably damaging Het
Ythdf1 A T 2: 180,912,188 M51K probably damaging Het
Zfp60 T A 7: 27,738,530 probably benign Het
Zfp882 T A 8: 71,914,360 F344I probably damaging Het
Other mutations in Bhlhe41
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01717:Bhlhe41 APN 6 145863037 missense possibly damaging 0.93
IGL02303:Bhlhe41 APN 6 145864156 missense probably damaging 1.00
IGL02885:Bhlhe41 APN 6 145865263 missense probably damaging 1.00
IGL03354:Bhlhe41 APN 6 145864203 missense probably damaging 1.00
R1124:Bhlhe41 UTSW 6 145863730 missense probably damaging 1.00
R3620:Bhlhe41 UTSW 6 145863007 missense possibly damaging 0.75
R4035:Bhlhe41 UTSW 6 145863028 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- TGTCGAGCATCGCTTACTC -3'
(R):5'- GACAAGTATCTGTACCCCGC -3'

Sequencing Primer
(F):5'- TTTGAACTTGGAAACCCGGC -3'
(R):5'- CTTGCTTGTCGTCCGTGCTG -3'
Posted On2016-07-22