Incidental Mutation 'R5296:Zfp60'
ID405413
Institutional Source Beutler Lab
Gene Symbol Zfp60
Ensembl Gene ENSMUSG00000037640
Gene Namezinc finger protein 60
Synonyms6330516O17Rik, Mfg-3, Mfg3
MMRRC Submission 042879-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5296 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location27731389-27753702 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to A at 27738530 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000132607 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042641] [ENSMUST00000108336] [ENSMUST00000130997] [ENSMUST00000136373] [ENSMUST00000167955]
Predicted Effect probably benign
Transcript: ENSMUST00000042641
SMART Domains Protein: ENSMUSP00000036627
Gene: ENSMUSG00000037640

DomainStartEndE-ValueType
KRAB 14 75 8.48e-36 SMART
ZnF_C2H2 173 195 2.67e-1 SMART
ZnF_C2H2 201 223 2.09e-3 SMART
ZnF_C2H2 229 251 1.18e-2 SMART
ZnF_C2H2 257 279 2.24e-3 SMART
ZnF_C2H2 285 307 2.65e-5 SMART
ZnF_C2H2 313 335 5.5e-3 SMART
ZnF_C2H2 341 363 3.89e-3 SMART
ZnF_C2H2 369 391 6.32e-3 SMART
ZnF_C2H2 397 419 5.14e-3 SMART
ZnF_C2H2 425 447 7.9e-4 SMART
ZnF_C2H2 453 475 1.67e-2 SMART
ZnF_C2H2 481 503 4.4e-2 SMART
ZnF_C2H2 509 531 4.24e-4 SMART
ZnF_C2H2 537 559 5.21e-4 SMART
ZnF_C2H2 565 587 5.14e-3 SMART
ZnF_C2H2 593 615 3.89e-3 SMART
ZnF_C2H2 621 643 1.95e-3 SMART
ZnF_C2H2 649 671 6.67e-2 SMART
ZnF_C2H2 677 699 8.34e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108336
SMART Domains Protein: ENSMUSP00000103973
Gene: ENSMUSG00000037640

DomainStartEndE-ValueType
KRAB 14 75 8.48e-36 SMART
ZnF_C2H2 173 195 2.67e-1 SMART
ZnF_C2H2 201 223 2.09e-3 SMART
ZnF_C2H2 229 251 1.18e-2 SMART
ZnF_C2H2 257 279 2.24e-3 SMART
ZnF_C2H2 285 307 2.65e-5 SMART
ZnF_C2H2 313 335 5.5e-3 SMART
ZnF_C2H2 341 363 3.89e-3 SMART
ZnF_C2H2 369 391 6.32e-3 SMART
ZnF_C2H2 397 419 5.14e-3 SMART
ZnF_C2H2 425 447 7.9e-4 SMART
ZnF_C2H2 453 475 1.67e-2 SMART
ZnF_C2H2 481 503 4.4e-2 SMART
ZnF_C2H2 509 531 4.24e-4 SMART
ZnF_C2H2 537 559 5.21e-4 SMART
ZnF_C2H2 565 587 5.14e-3 SMART
ZnF_C2H2 593 615 3.89e-3 SMART
ZnF_C2H2 621 643 1.95e-3 SMART
ZnF_C2H2 649 671 6.67e-2 SMART
ZnF_C2H2 677 699 8.34e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125228
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126884
Predicted Effect probably benign
Transcript: ENSMUST00000130997
SMART Domains Protein: ENSMUSP00000118469
Gene: ENSMUSG00000037640

DomainStartEndE-ValueType
KRAB 14 75 8.48e-36 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000136373
SMART Domains Protein: ENSMUSP00000117049
Gene: ENSMUSG00000037640

DomainStartEndE-ValueType
KRAB 14 55 3.2e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141753
Predicted Effect probably benign
Transcript: ENSMUST00000167955
SMART Domains Protein: ENSMUSP00000132607
Gene: ENSMUSG00000037640

DomainStartEndE-ValueType
KRAB 14 75 8.48e-36 SMART
ZnF_C2H2 173 195 2.67e-1 SMART
ZnF_C2H2 201 223 2.09e-3 SMART
ZnF_C2H2 229 251 1.18e-2 SMART
ZnF_C2H2 257 279 2.24e-3 SMART
ZnF_C2H2 285 307 2.65e-5 SMART
ZnF_C2H2 313 335 5.5e-3 SMART
ZnF_C2H2 341 363 3.89e-3 SMART
ZnF_C2H2 369 391 6.32e-3 SMART
ZnF_C2H2 397 419 5.14e-3 SMART
ZnF_C2H2 425 447 7.9e-4 SMART
ZnF_C2H2 453 475 1.67e-2 SMART
ZnF_C2H2 481 503 4.4e-2 SMART
ZnF_C2H2 509 531 4.24e-4 SMART
ZnF_C2H2 537 559 5.21e-4 SMART
ZnF_C2H2 565 587 5.14e-3 SMART
ZnF_C2H2 593 615 3.89e-3 SMART
ZnF_C2H2 621 643 1.95e-3 SMART
ZnF_C2H2 649 671 6.67e-2 SMART
ZnF_C2H2 677 699 8.34e-3 SMART
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.9%
  • 10x: 97.9%
  • 20x: 96.6%
Validation Efficiency 100% (65/65)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apobr A C 7: 126,588,024 D89A probably damaging Het
Bhlhe41 C T 6: 145,862,968 probably benign Het
Cacna1s G A 1: 136,095,785 V674M probably benign Het
Cavin2 T C 1: 51,289,870 probably null Het
Cd300lb T C 11: 114,924,937 S106G possibly damaging Het
Ceacam15 A G 7: 16,673,196 V132A probably benign Het
Ddi2 G T 4: 141,684,765 Q279K probably benign Het
Dnah11 A G 12: 117,883,416 V4304A probably damaging Het
Dnah2 C T 11: 69,458,920 R2399Q probably benign Het
Dnase1l1 C T X: 74,277,038 probably null Het
Epsti1 T A 14: 77,904,650 H55Q probably benign Het
Flad1 T C 3: 89,411,196 T17A probably damaging Het
Fzd2 C T 11: 102,606,155 T475M probably damaging Het
Gemin5 C A 11: 58,130,061 W1099L probably damaging Het
Gm8979 A T 7: 106,081,848 noncoding transcript Het
Gm9892 T C 8: 52,196,929 noncoding transcript Het
Gmeb2 A G 2: 181,255,986 probably benign Het
Grip1 A G 10: 119,929,928 E55G probably damaging Het
Hltf T C 3: 20,108,112 S825P probably damaging Het
Kcnh3 A T 15: 99,241,939 Q902L probably null Het
Kcnt2 C T 1: 140,609,615 P1037L probably damaging Het
Klhl18 G C 9: 110,436,127 N335K possibly damaging Het
Lama5 A C 2: 180,193,801 L1253R probably damaging Het
Lancl2 T G 6: 57,724,582 S230A probably benign Het
Lmcd1 A G 6: 112,315,588 M134V probably damaging Het
Lrrc23 C A 6: 124,774,482 A205S probably damaging Het
Mfsd13b T A 7: 120,991,738 I234N probably damaging Het
Mroh3 A G 1: 136,196,323 S386P probably damaging Het
Mylk3 A C 8: 85,355,431 F313V possibly damaging Het
Myo9b A T 8: 71,333,388 Q643L possibly damaging Het
Nacad T C 11: 6,605,745 S2G unknown Het
Olfr1269 A T 2: 90,118,699 W300R probably damaging Het
Olfr136 C T 17: 38,335,456 Q100* probably null Het
Olfr419 G T 1: 174,250,756 T57K possibly damaging Het
Olfr908 T C 9: 38,516,116 F28S probably damaging Het
Pkd1 T C 17: 24,576,074 V2245A probably damaging Het
Pkdrej G A 15: 85,817,118 T1539I possibly damaging Het
Plch2 G T 4: 154,989,999 probably null Het
Pygm G A 19: 6,384,579 R34H probably damaging Het
Rgs12 T C 5: 35,021,104 probably benign Het
Ruvbl1 T C 6: 88,485,908 I338T probably damaging Het
Sapcd1 T A 17: 35,026,731 Q104L probably damaging Het
Satb2 T C 1: 56,796,907 E575G probably damaging Het
Sema6b T A 17: 56,127,091 probably null Het
Slc25a11 T C 11: 70,646,185 N15D probably damaging Het
Slc26a6 C T 9: 108,860,646 T526M probably damaging Het
Tcaf3 G T 6: 42,587,510 T906K possibly damaging Het
Thbd A T 2: 148,406,983 C322S probably damaging Het
Traf2 A G 2: 25,520,440 L399P probably damaging Het
Troap T A 15: 99,078,817 V274D probably damaging Het
Utrn G A 10: 12,401,355 T3406M probably damaging Het
Uts2 G T 4: 150,999,051 A40S possibly damaging Het
Vmn2r109 T A 17: 20,554,341 I251F possibly damaging Het
Vmn2r67 A G 7: 85,137,022 S592P probably damaging Het
Vps13b T G 15: 35,876,413 W2797G probably damaging Het
Ythdf1 A T 2: 180,912,188 M51K probably damaging Het
Zfp882 T A 8: 71,914,360 F344I probably damaging Het
Other mutations in Zfp60
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03353:Zfp60 APN 7 27748334 nonsense probably null
PIT4494001:Zfp60 UTSW 7 27748701 missense probably damaging 1.00
R1281:Zfp60 UTSW 7 27738427 missense probably damaging 1.00
R1643:Zfp60 UTSW 7 27736975 missense probably damaging 0.98
R1883:Zfp60 UTSW 7 27750010 missense probably benign 0.00
R1930:Zfp60 UTSW 7 27736957 start codon destroyed probably null 1.00
R3623:Zfp60 UTSW 7 27749328 missense probably benign 0.01
R3624:Zfp60 UTSW 7 27749328 missense probably benign 0.01
R3875:Zfp60 UTSW 7 27749581 missense probably damaging 1.00
R5491:Zfp60 UTSW 7 27748515 splice site probably null
R5724:Zfp60 UTSW 7 27748333 missense probably benign
R6134:Zfp60 UTSW 7 27749898 missense probably benign 0.01
R6312:Zfp60 UTSW 7 27748776 missense probably damaging 0.99
R6477:Zfp60 UTSW 7 27749803 missense probably benign 0.00
R6649:Zfp60 UTSW 7 27748726 missense probably benign 0.00
R6653:Zfp60 UTSW 7 27748726 missense probably benign 0.00
R7041:Zfp60 UTSW 7 27749026 missense probably benign 0.05
R7166:Zfp60 UTSW 7 27749512 missense possibly damaging 0.82
R7185:Zfp60 UTSW 7 27738405 missense probably damaging 1.00
R7334:Zfp60 UTSW 7 27749019 missense probably damaging 1.00
R7560:Zfp60 UTSW 7 27749136 missense probably damaging 0.99
R7560:Zfp60 UTSW 7 27749271 missense probably damaging 1.00
R7561:Zfp60 UTSW 7 27748530 missense probably damaging 1.00
R7673:Zfp60 UTSW 7 27748315 missense probably benign 0.00
R7961:Zfp60 UTSW 7 27748456 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GAAAGCTTCCCCAGTTTCACTC -3'
(R):5'- CCAAGTTATCTCTCTAGCACGC -3'

Sequencing Primer
(F):5'- CTCTTTCAGGGGTCAGTGAC -3'
(R):5'- CCTGGAACTCACTGTGTA -3'
Posted On2016-07-22