Incidental Mutation 'R5296:Zfp60'
ID 405413
Institutional Source Beutler Lab
Gene Symbol Zfp60
Ensembl Gene ENSMUSG00000037640
Gene Name zinc finger protein 60
Synonyms Mfg-3, Mfg3, 6330516O17Rik
MMRRC Submission 042879-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5296 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 27430834-27451114 bp(+) (GRCm39)
Type of Mutation intron
DNA Base Change (assembly) T to A at 27437955 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000132607 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042641] [ENSMUST00000108336] [ENSMUST00000130997] [ENSMUST00000136373] [ENSMUST00000167955]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000042641
SMART Domains Protein: ENSMUSP00000036627
Gene: ENSMUSG00000037640

DomainStartEndE-ValueType
KRAB 14 75 8.48e-36 SMART
ZnF_C2H2 173 195 2.67e-1 SMART
ZnF_C2H2 201 223 2.09e-3 SMART
ZnF_C2H2 229 251 1.18e-2 SMART
ZnF_C2H2 257 279 2.24e-3 SMART
ZnF_C2H2 285 307 2.65e-5 SMART
ZnF_C2H2 313 335 5.5e-3 SMART
ZnF_C2H2 341 363 3.89e-3 SMART
ZnF_C2H2 369 391 6.32e-3 SMART
ZnF_C2H2 397 419 5.14e-3 SMART
ZnF_C2H2 425 447 7.9e-4 SMART
ZnF_C2H2 453 475 1.67e-2 SMART
ZnF_C2H2 481 503 4.4e-2 SMART
ZnF_C2H2 509 531 4.24e-4 SMART
ZnF_C2H2 537 559 5.21e-4 SMART
ZnF_C2H2 565 587 5.14e-3 SMART
ZnF_C2H2 593 615 3.89e-3 SMART
ZnF_C2H2 621 643 1.95e-3 SMART
ZnF_C2H2 649 671 6.67e-2 SMART
ZnF_C2H2 677 699 8.34e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108336
SMART Domains Protein: ENSMUSP00000103973
Gene: ENSMUSG00000037640

DomainStartEndE-ValueType
KRAB 14 75 8.48e-36 SMART
ZnF_C2H2 173 195 2.67e-1 SMART
ZnF_C2H2 201 223 2.09e-3 SMART
ZnF_C2H2 229 251 1.18e-2 SMART
ZnF_C2H2 257 279 2.24e-3 SMART
ZnF_C2H2 285 307 2.65e-5 SMART
ZnF_C2H2 313 335 5.5e-3 SMART
ZnF_C2H2 341 363 3.89e-3 SMART
ZnF_C2H2 369 391 6.32e-3 SMART
ZnF_C2H2 397 419 5.14e-3 SMART
ZnF_C2H2 425 447 7.9e-4 SMART
ZnF_C2H2 453 475 1.67e-2 SMART
ZnF_C2H2 481 503 4.4e-2 SMART
ZnF_C2H2 509 531 4.24e-4 SMART
ZnF_C2H2 537 559 5.21e-4 SMART
ZnF_C2H2 565 587 5.14e-3 SMART
ZnF_C2H2 593 615 3.89e-3 SMART
ZnF_C2H2 621 643 1.95e-3 SMART
ZnF_C2H2 649 671 6.67e-2 SMART
ZnF_C2H2 677 699 8.34e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125228
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126884
Predicted Effect probably benign
Transcript: ENSMUST00000130997
SMART Domains Protein: ENSMUSP00000118469
Gene: ENSMUSG00000037640

DomainStartEndE-ValueType
KRAB 14 75 8.48e-36 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000136373
SMART Domains Protein: ENSMUSP00000117049
Gene: ENSMUSG00000037640

DomainStartEndE-ValueType
KRAB 14 55 3.2e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141753
Predicted Effect probably benign
Transcript: ENSMUST00000167955
SMART Domains Protein: ENSMUSP00000132607
Gene: ENSMUSG00000037640

DomainStartEndE-ValueType
KRAB 14 75 8.48e-36 SMART
ZnF_C2H2 173 195 2.67e-1 SMART
ZnF_C2H2 201 223 2.09e-3 SMART
ZnF_C2H2 229 251 1.18e-2 SMART
ZnF_C2H2 257 279 2.24e-3 SMART
ZnF_C2H2 285 307 2.65e-5 SMART
ZnF_C2H2 313 335 5.5e-3 SMART
ZnF_C2H2 341 363 3.89e-3 SMART
ZnF_C2H2 369 391 6.32e-3 SMART
ZnF_C2H2 397 419 5.14e-3 SMART
ZnF_C2H2 425 447 7.9e-4 SMART
ZnF_C2H2 453 475 1.67e-2 SMART
ZnF_C2H2 481 503 4.4e-2 SMART
ZnF_C2H2 509 531 4.24e-4 SMART
ZnF_C2H2 537 559 5.21e-4 SMART
ZnF_C2H2 565 587 5.14e-3 SMART
ZnF_C2H2 593 615 3.89e-3 SMART
ZnF_C2H2 621 643 1.95e-3 SMART
ZnF_C2H2 649 671 6.67e-2 SMART
ZnF_C2H2 677 699 8.34e-3 SMART
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.9%
  • 10x: 97.9%
  • 20x: 96.6%
Validation Efficiency 100% (65/65)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apobr A C 7: 126,187,196 (GRCm39) D89A probably damaging Het
Bhlhe41 C T 6: 145,808,694 (GRCm39) probably benign Het
Cacna1s G A 1: 136,023,523 (GRCm39) V674M probably benign Het
Cavin2 T C 1: 51,329,029 (GRCm39) probably null Het
Cd300lb T C 11: 114,815,763 (GRCm39) S106G possibly damaging Het
Ceacam15 A G 7: 16,407,121 (GRCm39) V132A probably benign Het
Ddi2 G T 4: 141,412,076 (GRCm39) Q279K probably benign Het
Dnah11 A G 12: 117,847,151 (GRCm39) V4304A probably damaging Het
Dnah2 C T 11: 69,349,746 (GRCm39) R2399Q probably benign Het
Dnase1l1 C T X: 73,320,644 (GRCm39) probably null Het
Epsti1 T A 14: 78,142,090 (GRCm39) H55Q probably benign Het
Flad1 T C 3: 89,318,503 (GRCm39) T17A probably damaging Het
Fzd2 C T 11: 102,496,981 (GRCm39) T475M probably damaging Het
Gemin5 C A 11: 58,020,887 (GRCm39) W1099L probably damaging Het
Gm9892 T C 8: 52,649,964 (GRCm39) noncoding transcript Het
Gmeb2 A G 2: 180,897,779 (GRCm39) probably benign Het
Grip1 A G 10: 119,765,833 (GRCm39) E55G probably damaging Het
Gvin-ps3 A T 7: 105,681,055 (GRCm39) noncoding transcript Het
Hltf T C 3: 20,162,276 (GRCm39) S825P probably damaging Het
Kcnh3 A T 15: 99,139,820 (GRCm39) Q902L probably null Het
Kcnt2 C T 1: 140,537,353 (GRCm39) P1037L probably damaging Het
Klhl18 G C 9: 110,265,195 (GRCm39) N335K possibly damaging Het
Lama5 A C 2: 179,835,594 (GRCm39) L1253R probably damaging Het
Lancl2 T G 6: 57,701,567 (GRCm39) S230A probably benign Het
Lmcd1 A G 6: 112,292,549 (GRCm39) M134V probably damaging Het
Lrrc23 C A 6: 124,751,445 (GRCm39) A205S probably damaging Het
Mfsd13b T A 7: 120,590,961 (GRCm39) I234N probably damaging Het
Mroh3 A G 1: 136,124,061 (GRCm39) S386P probably damaging Het
Mylk3 A C 8: 86,082,060 (GRCm39) F313V possibly damaging Het
Myo9b A T 8: 71,786,032 (GRCm39) Q643L possibly damaging Het
Nacad T C 11: 6,555,745 (GRCm39) S2G unknown Het
Olfr908 T C 9: 38,427,412 (GRCm39) F28S probably damaging Het
Or10z1 G T 1: 174,078,322 (GRCm39) T57K possibly damaging Het
Or2n1d C T 17: 38,646,347 (GRCm39) Q100* probably null Het
Or4x6 A T 2: 89,949,043 (GRCm39) W300R probably damaging Het
Pkd1 T C 17: 24,795,048 (GRCm39) V2245A probably damaging Het
Pkdrej G A 15: 85,701,319 (GRCm39) T1539I possibly damaging Het
Plch2 G T 4: 155,074,456 (GRCm39) probably null Het
Pygm G A 19: 6,434,609 (GRCm39) R34H probably damaging Het
Rgs12 T C 5: 35,178,448 (GRCm39) probably benign Het
Ruvbl1 T C 6: 88,462,890 (GRCm39) I338T probably damaging Het
Sapcd1 T A 17: 35,245,707 (GRCm39) Q104L probably damaging Het
Satb2 T C 1: 56,836,066 (GRCm39) E575G probably damaging Het
Sema6b T A 17: 56,434,091 (GRCm39) probably null Het
Slc25a11 T C 11: 70,537,011 (GRCm39) N15D probably damaging Het
Slc26a6 C T 9: 108,737,845 (GRCm39) T526M probably damaging Het
Tcaf3 G T 6: 42,564,444 (GRCm39) T906K possibly damaging Het
Thbd A T 2: 148,248,903 (GRCm39) C322S probably damaging Het
Traf2 A G 2: 25,410,452 (GRCm39) L399P probably damaging Het
Troap T A 15: 98,976,698 (GRCm39) V274D probably damaging Het
Utrn G A 10: 12,277,099 (GRCm39) T3406M probably damaging Het
Uts2 G T 4: 151,083,508 (GRCm39) A40S possibly damaging Het
Vmn2r109 T A 17: 20,774,603 (GRCm39) I251F possibly damaging Het
Vmn2r67 A G 7: 84,786,230 (GRCm39) S592P probably damaging Het
Vps13b T G 15: 35,876,559 (GRCm39) W2797G probably damaging Het
Ythdf1 A T 2: 180,553,981 (GRCm39) M51K probably damaging Het
Zfp882 T A 8: 72,668,204 (GRCm39) F344I probably damaging Het
Other mutations in Zfp60
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03353:Zfp60 APN 7 27,447,759 (GRCm39) nonsense probably null
PIT4494001:Zfp60 UTSW 7 27,448,126 (GRCm39) missense probably damaging 1.00
R1281:Zfp60 UTSW 7 27,437,852 (GRCm39) missense probably damaging 1.00
R1643:Zfp60 UTSW 7 27,436,400 (GRCm39) missense probably damaging 0.98
R1883:Zfp60 UTSW 7 27,449,435 (GRCm39) missense probably benign 0.00
R1930:Zfp60 UTSW 7 27,436,382 (GRCm39) start codon destroyed probably null 1.00
R3623:Zfp60 UTSW 7 27,448,753 (GRCm39) missense probably benign 0.01
R3624:Zfp60 UTSW 7 27,448,753 (GRCm39) missense probably benign 0.01
R3875:Zfp60 UTSW 7 27,449,006 (GRCm39) missense probably damaging 1.00
R5491:Zfp60 UTSW 7 27,447,940 (GRCm39) splice site probably null
R5724:Zfp60 UTSW 7 27,447,758 (GRCm39) missense probably benign
R6134:Zfp60 UTSW 7 27,449,323 (GRCm39) missense probably benign 0.01
R6312:Zfp60 UTSW 7 27,448,201 (GRCm39) missense probably damaging 0.99
R6477:Zfp60 UTSW 7 27,449,228 (GRCm39) missense probably benign 0.00
R6649:Zfp60 UTSW 7 27,448,151 (GRCm39) missense probably benign 0.00
R6653:Zfp60 UTSW 7 27,448,151 (GRCm39) missense probably benign 0.00
R7041:Zfp60 UTSW 7 27,448,451 (GRCm39) missense probably benign 0.05
R7166:Zfp60 UTSW 7 27,448,937 (GRCm39) missense possibly damaging 0.82
R7185:Zfp60 UTSW 7 27,437,830 (GRCm39) missense probably damaging 1.00
R7334:Zfp60 UTSW 7 27,448,444 (GRCm39) missense probably damaging 1.00
R7560:Zfp60 UTSW 7 27,448,696 (GRCm39) missense probably damaging 1.00
R7560:Zfp60 UTSW 7 27,448,561 (GRCm39) missense probably damaging 0.99
R7561:Zfp60 UTSW 7 27,447,955 (GRCm39) missense probably damaging 1.00
R7673:Zfp60 UTSW 7 27,447,740 (GRCm39) missense probably benign 0.00
R7961:Zfp60 UTSW 7 27,447,881 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GAAAGCTTCCCCAGTTTCACTC -3'
(R):5'- CCAAGTTATCTCTCTAGCACGC -3'

Sequencing Primer
(F):5'- CTCTTTCAGGGGTCAGTGAC -3'
(R):5'- CCTGGAACTCACTGTGTA -3'
Posted On 2016-07-22