Incidental Mutation 'R5296:Apobr'
ID405417
Institutional Source Beutler Lab
Gene Symbol Apobr
Ensembl Gene ENSMUSG00000042759
Gene Nameapolipoprotein B receptor
SynonymsApob-48r, Apob48r
MMRRC Submission 042879-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R5296 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location126584942-126589112 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 126588024 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 89 (D89A)
Ref Sequence ENSEMBL: ENSMUSP00000145535 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032962] [ENSMUST00000039522] [ENSMUST00000058429] [ENSMUST00000084589] [ENSMUST00000098036] [ENSMUST00000116269] [ENSMUST00000125508] [ENSMUST00000128970] [ENSMUST00000131860] [ENSMUST00000144173] [ENSMUST00000137646] [ENSMUST00000138558] [ENSMUST00000150311] [ENSMUST00000147086] [ENSMUST00000150917] [ENSMUST00000150587]
Predicted Effect probably benign
Transcript: ENSMUST00000032962
SMART Domains Protein: ENSMUSP00000032962
Gene: ENSMUSG00000030720

DomainStartEndE-ValueType
Pfam:CLN3 37 438 3.5e-215 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000039522
AA Change: D874A

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000042028
Gene: ENSMUSG00000042759
AA Change: D874A

DomainStartEndE-ValueType
low complexity region 45 59 N/A INTRINSIC
low complexity region 171 181 N/A INTRINSIC
low complexity region 351 363 N/A INTRINSIC
low complexity region 381 396 N/A INTRINSIC
low complexity region 465 476 N/A INTRINSIC
low complexity region 588 608 N/A INTRINSIC
low complexity region 837 862 N/A INTRINSIC
low complexity region 869 881 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000058429
SMART Domains Protein: ENSMUSP00000054637
Gene: ENSMUSG00000044701

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
low complexity region 137 148 N/A INTRINSIC
low complexity region 160 177 N/A INTRINSIC
low complexity region 210 228 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000084589
SMART Domains Protein: ENSMUSP00000081636
Gene: ENSMUSG00000030720

DomainStartEndE-ValueType
Pfam:CLN3 37 438 3.5e-215 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000098036
SMART Domains Protein: ENSMUSP00000095644
Gene: ENSMUSG00000030720

DomainStartEndE-ValueType
Pfam:CLN3 37 414 4.3e-191 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000116269
SMART Domains Protein: ENSMUSP00000111973
Gene: ENSMUSG00000030720

DomainStartEndE-ValueType
Pfam:CLN3 39 437 1.6e-140 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000125508
SMART Domains Protein: ENSMUSP00000117561
Gene: ENSMUSG00000030720

DomainStartEndE-ValueType
Pfam:CLN3 37 76 1.2e-17 PFAM
Pfam:CLN3 73 151 2.8e-38 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128049
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128225
Predicted Effect probably benign
Transcript: ENSMUST00000128970
SMART Domains Protein: ENSMUSP00000114901
Gene: ENSMUSG00000030720

DomainStartEndE-ValueType
Pfam:CLN3 37 196 1.2e-87 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131860
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134246
Predicted Effect probably damaging
Transcript: ENSMUST00000144173
AA Change: D89A

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
Predicted Effect unknown
Transcript: ENSMUST00000137646
AA Change: D62A
Predicted Effect unknown
Transcript: ENSMUST00000138558
AA Change: D96A
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134406
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134498
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153790
Predicted Effect probably benign
Transcript: ENSMUST00000150311
SMART Domains Protein: ENSMUSP00000116160
Gene: ENSMUSG00000030720

DomainStartEndE-ValueType
Pfam:CLN3 37 69 1.5e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147086
Predicted Effect probably benign
Transcript: ENSMUST00000150917
SMART Domains Protein: ENSMUSP00000138688
Gene: ENSMUSG00000030720

DomainStartEndE-ValueType
Pfam:CLN3 37 77 1.6e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000150587
SMART Domains Protein: ENSMUSP00000118054
Gene: ENSMUSG00000030720

DomainStartEndE-ValueType
Pfam:CLN3 37 70 4.1e-15 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.9%
  • 10x: 97.9%
  • 20x: 96.6%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Apolipoprotein B48 receptor is a macrophage receptor that binds to the apolipoprotein B48 of dietary triglyceride (TG)-rich lipoproteins. This receptor may provide essential lipids, lipid-soluble vitamins and other nutrients to reticuloendothelial cells. If overwhelmed with elevated plasma triglyceride, the apolipoprotein B48 receptor may contribute to foam cell formation, endothelial dysfunction, and atherothrombogenesis. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bhlhe41 C T 6: 145,862,968 probably benign Het
Cacna1s G A 1: 136,095,785 V674M probably benign Het
Cavin2 T C 1: 51,289,870 probably null Het
Cd300lb T C 11: 114,924,937 S106G possibly damaging Het
Ceacam15 A G 7: 16,673,196 V132A probably benign Het
Ddi2 G T 4: 141,684,765 Q279K probably benign Het
Dnah11 A G 12: 117,883,416 V4304A probably damaging Het
Dnah2 C T 11: 69,458,920 R2399Q probably benign Het
Dnase1l1 C T X: 74,277,038 probably null Het
Epsti1 T A 14: 77,904,650 H55Q probably benign Het
Flad1 T C 3: 89,411,196 T17A probably damaging Het
Fzd2 C T 11: 102,606,155 T475M probably damaging Het
Gemin5 C A 11: 58,130,061 W1099L probably damaging Het
Gm8979 A T 7: 106,081,848 noncoding transcript Het
Gm9892 T C 8: 52,196,929 noncoding transcript Het
Gmeb2 A G 2: 181,255,986 probably benign Het
Grip1 A G 10: 119,929,928 E55G probably damaging Het
Hltf T C 3: 20,108,112 S825P probably damaging Het
Kcnh3 A T 15: 99,241,939 Q902L probably null Het
Kcnt2 C T 1: 140,609,615 P1037L probably damaging Het
Klhl18 G C 9: 110,436,127 N335K possibly damaging Het
Lama5 A C 2: 180,193,801 L1253R probably damaging Het
Lancl2 T G 6: 57,724,582 S230A probably benign Het
Lmcd1 A G 6: 112,315,588 M134V probably damaging Het
Lrrc23 C A 6: 124,774,482 A205S probably damaging Het
Mfsd13b T A 7: 120,991,738 I234N probably damaging Het
Mroh3 A G 1: 136,196,323 S386P probably damaging Het
Mylk3 A C 8: 85,355,431 F313V possibly damaging Het
Myo9b A T 8: 71,333,388 Q643L possibly damaging Het
Nacad T C 11: 6,605,745 S2G unknown Het
Olfr1269 A T 2: 90,118,699 W300R probably damaging Het
Olfr136 C T 17: 38,335,456 Q100* probably null Het
Olfr419 G T 1: 174,250,756 T57K possibly damaging Het
Olfr908 T C 9: 38,516,116 F28S probably damaging Het
Pkd1 T C 17: 24,576,074 V2245A probably damaging Het
Pkdrej G A 15: 85,817,118 T1539I possibly damaging Het
Plch2 G T 4: 154,989,999 probably null Het
Pygm G A 19: 6,384,579 R34H probably damaging Het
Rgs12 T C 5: 35,021,104 probably benign Het
Ruvbl1 T C 6: 88,485,908 I338T probably damaging Het
Sapcd1 T A 17: 35,026,731 Q104L probably damaging Het
Satb2 T C 1: 56,796,907 E575G probably damaging Het
Sema6b T A 17: 56,127,091 probably null Het
Slc25a11 T C 11: 70,646,185 N15D probably damaging Het
Slc26a6 C T 9: 108,860,646 T526M probably damaging Het
Tcaf3 G T 6: 42,587,510 T906K possibly damaging Het
Thbd A T 2: 148,406,983 C322S probably damaging Het
Traf2 A G 2: 25,520,440 L399P probably damaging Het
Troap T A 15: 99,078,817 V274D probably damaging Het
Utrn G A 10: 12,401,355 T3406M probably damaging Het
Uts2 G T 4: 150,999,051 A40S possibly damaging Het
Vmn2r109 T A 17: 20,554,341 I251F possibly damaging Het
Vmn2r67 A G 7: 85,137,022 S592P probably damaging Het
Vps13b T G 15: 35,876,413 W2797G probably damaging Het
Ythdf1 A T 2: 180,912,188 M51K probably damaging Het
Zfp60 T A 7: 27,738,530 probably benign Het
Zfp882 T A 8: 71,914,360 F344I probably damaging Het
Other mutations in Apobr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01812:Apobr APN 7 126587922 missense probably damaging 1.00
IGL02373:Apobr APN 7 126585391 missense probably damaging 1.00
IGL02383:Apobr APN 7 126586607 missense probably benign 0.35
R0626:Apobr UTSW 7 126586655 missense possibly damaging 0.73
R1142:Apobr UTSW 7 126587482 missense probably benign 0.01
R1672:Apobr UTSW 7 126587551 missense probably benign 0.31
R1711:Apobr UTSW 7 126584979 start gained probably null
R1865:Apobr UTSW 7 126585968 missense probably benign 0.00
R1971:Apobr UTSW 7 126586225 missense probably benign 0.00
R1985:Apobr UTSW 7 126587731 missense possibly damaging 0.66
R2130:Apobr UTSW 7 126587206 missense probably benign 0.15
R2143:Apobr UTSW 7 126587116 missense probably benign 0.01
R4497:Apobr UTSW 7 126587522 splice site probably null
R4693:Apobr UTSW 7 126586847 missense probably damaging 0.96
R4797:Apobr UTSW 7 126587584 missense probably benign 0.30
R4814:Apobr UTSW 7 126586687 missense probably benign 0.03
R5000:Apobr UTSW 7 126586557 missense possibly damaging 0.53
R5153:Apobr UTSW 7 126587732 missense possibly damaging 0.92
R5176:Apobr UTSW 7 126585016 missense probably damaging 1.00
R5285:Apobr UTSW 7 126585003 unclassified probably benign
R5579:Apobr UTSW 7 126587675 missense probably benign 0.00
Z1088:Apobr UTSW 7 126585031 missense probably benign 0.00
Z1176:Apobr UTSW 7 126587264 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ACAGGCAGAATCTGGAAGTC -3'
(R):5'- TCCATAAGAGCTCTGGGAGGTG -3'

Sequencing Primer
(F):5'- GCAGAATCTGGAAGTCAGTTCTCC -3'
(R):5'- AGCTCTGGGAGGTGGACCC -3'
Posted On2016-07-22