Incidental Mutation 'R5296:Mylk3'
ID405422
Institutional Source Beutler Lab
Gene Symbol Mylk3
Ensembl Gene ENSMUSG00000031698
Gene Namemyosin light chain kinase 3
Synonyms
MMRRC Submission 042879-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.223) question?
Stock #R5296 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location85324303-85386345 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 85355431 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Valine at position 313 (F313V)
Ref Sequence ENSEMBL: ENSMUSP00000113960 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034133] [ENSMUST00000121972] [ENSMUST00000122452] [ENSMUST00000137290]
Predicted Effect probably benign
Transcript: ENSMUST00000034133
AA Change: F376V

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000034133
Gene: ENSMUSG00000031698
AA Change: F376V

DomainStartEndE-ValueType
low complexity region 11 26 N/A INTRINSIC
low complexity region 304 316 N/A INTRINSIC
S_TKc 491 746 6.93e-91 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000121972
AA Change: F313V

PolyPhen 2 Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000113960
Gene: ENSMUSG00000031698
AA Change: F313V

DomainStartEndE-ValueType
low complexity region 11 26 N/A INTRINSIC
low complexity region 241 253 N/A INTRINSIC
S_TKc 428 683 6.93e-91 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000122452
AA Change: F243V

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000113389
Gene: ENSMUSG00000031698
AA Change: F243V

DomainStartEndE-ValueType
low complexity region 171 183 N/A INTRINSIC
S_TKc 358 613 6.93e-91 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000137290
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138825
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.9%
  • 10x: 97.9%
  • 20x: 96.6%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphorylation of cardiac myosin heavy chains (see MYH7B, MIM 609928) and light chains (see MYL2, MIM 160781) by a kinase, such as MYLK3, potentiates the force and rate of cross-bridge recruitment in cardiac myocytes (Chan et al., 2008 [PubMed 18202317]).[supplied by OMIM, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit cardiac hypertrophy, reduced cardiac function and increased response of heart to induced stress. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apobr A C 7: 126,588,024 D89A probably damaging Het
Bhlhe41 C T 6: 145,862,968 probably benign Het
Cacna1s G A 1: 136,095,785 V674M probably benign Het
Cavin2 T C 1: 51,289,870 probably null Het
Cd300lb T C 11: 114,924,937 S106G possibly damaging Het
Ceacam15 A G 7: 16,673,196 V132A probably benign Het
Ddi2 G T 4: 141,684,765 Q279K probably benign Het
Dnah11 A G 12: 117,883,416 V4304A probably damaging Het
Dnah2 C T 11: 69,458,920 R2399Q probably benign Het
Dnase1l1 C T X: 74,277,038 probably null Het
Epsti1 T A 14: 77,904,650 H55Q probably benign Het
Flad1 T C 3: 89,411,196 T17A probably damaging Het
Fzd2 C T 11: 102,606,155 T475M probably damaging Het
Gemin5 C A 11: 58,130,061 W1099L probably damaging Het
Gm8979 A T 7: 106,081,848 noncoding transcript Het
Gm9892 T C 8: 52,196,929 noncoding transcript Het
Gmeb2 A G 2: 181,255,986 probably benign Het
Grip1 A G 10: 119,929,928 E55G probably damaging Het
Hltf T C 3: 20,108,112 S825P probably damaging Het
Kcnh3 A T 15: 99,241,939 Q902L probably null Het
Kcnt2 C T 1: 140,609,615 P1037L probably damaging Het
Klhl18 G C 9: 110,436,127 N335K possibly damaging Het
Lama5 A C 2: 180,193,801 L1253R probably damaging Het
Lancl2 T G 6: 57,724,582 S230A probably benign Het
Lmcd1 A G 6: 112,315,588 M134V probably damaging Het
Lrrc23 C A 6: 124,774,482 A205S probably damaging Het
Mfsd13b T A 7: 120,991,738 I234N probably damaging Het
Mroh3 A G 1: 136,196,323 S386P probably damaging Het
Myo9b A T 8: 71,333,388 Q643L possibly damaging Het
Nacad T C 11: 6,605,745 S2G unknown Het
Olfr1269 A T 2: 90,118,699 W300R probably damaging Het
Olfr136 C T 17: 38,335,456 Q100* probably null Het
Olfr419 G T 1: 174,250,756 T57K possibly damaging Het
Olfr908 T C 9: 38,516,116 F28S probably damaging Het
Pkd1 T C 17: 24,576,074 V2245A probably damaging Het
Pkdrej G A 15: 85,817,118 T1539I possibly damaging Het
Plch2 G T 4: 154,989,999 probably null Het
Pygm G A 19: 6,384,579 R34H probably damaging Het
Rgs12 T C 5: 35,021,104 probably benign Het
Ruvbl1 T C 6: 88,485,908 I338T probably damaging Het
Sapcd1 T A 17: 35,026,731 Q104L probably damaging Het
Satb2 T C 1: 56,796,907 E575G probably damaging Het
Sema6b T A 17: 56,127,091 probably null Het
Slc25a11 T C 11: 70,646,185 N15D probably damaging Het
Slc26a6 C T 9: 108,860,646 T526M probably damaging Het
Tcaf3 G T 6: 42,587,510 T906K possibly damaging Het
Thbd A T 2: 148,406,983 C322S probably damaging Het
Traf2 A G 2: 25,520,440 L399P probably damaging Het
Troap T A 15: 99,078,817 V274D probably damaging Het
Utrn G A 10: 12,401,355 T3406M probably damaging Het
Uts2 G T 4: 150,999,051 A40S possibly damaging Het
Vmn2r109 T A 17: 20,554,341 I251F possibly damaging Het
Vmn2r67 A G 7: 85,137,022 S592P probably damaging Het
Vps13b T G 15: 35,876,413 W2797G probably damaging Het
Ythdf1 A T 2: 180,912,188 M51K probably damaging Het
Zfp60 T A 7: 27,738,530 probably benign Het
Zfp882 T A 8: 71,914,360 F344I probably damaging Het
Other mutations in Mylk3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00978:Mylk3 APN 8 85355526 nonsense probably null
IGL01088:Mylk3 APN 8 85351957 splice site probably null
IGL01431:Mylk3 APN 8 85336401 missense probably damaging 1.00
IGL01488:Mylk3 APN 8 85352027 missense probably damaging 1.00
IGL01550:Mylk3 APN 8 85365089 missense probably damaging 1.00
IGL01786:Mylk3 APN 8 85359317 missense probably benign 0.27
IGL01877:Mylk3 APN 8 85359042 missense possibly damaging 0.66
IGL01995:Mylk3 APN 8 85359261 missense possibly damaging 0.83
IGL02003:Mylk3 APN 8 85359098 missense probably benign
IGL02251:Mylk3 APN 8 85355176 missense probably benign 0.04
IGL02252:Mylk3 APN 8 85355476 missense probably benign 0.04
IGL02341:Mylk3 APN 8 85351972 missense probably damaging 1.00
IGL02352:Mylk3 APN 8 85355302 missense probably benign 0.00
IGL02359:Mylk3 APN 8 85355302 missense probably benign 0.00
IGL03000:Mylk3 APN 8 85359177 missense probably damaging 0.97
IGL03185:Mylk3 APN 8 85327204 missense probably damaging 0.97
IGL03404:Mylk3 APN 8 85342681 missense probably damaging 1.00
R0005:Mylk3 UTSW 8 85327203 missense possibly damaging 0.93
R0219:Mylk3 UTSW 8 85355244 missense probably damaging 0.99
R0324:Mylk3 UTSW 8 85352906 missense probably damaging 0.98
R0402:Mylk3 UTSW 8 85352910 missense probably damaging 1.00
R0667:Mylk3 UTSW 8 85355165 critical splice donor site probably null
R1711:Mylk3 UTSW 8 85364831 missense probably damaging 1.00
R1857:Mylk3 UTSW 8 85328594 missense probably damaging 0.98
R1875:Mylk3 UTSW 8 85352865 missense probably damaging 1.00
R1878:Mylk3 UTSW 8 85355399 missense possibly damaging 0.82
R1916:Mylk3 UTSW 8 85327192 missense probably damaging 1.00
R3887:Mylk3 UTSW 8 85352047 missense probably damaging 1.00
R4081:Mylk3 UTSW 8 85328682 missense probably damaging 1.00
R4775:Mylk3 UTSW 8 85359060 nonsense probably null
R4796:Mylk3 UTSW 8 85350385 missense probably damaging 1.00
R4974:Mylk3 UTSW 8 85364783 missense probably damaging 0.97
R5108:Mylk3 UTSW 8 85359092 missense possibly damaging 0.83
R5194:Mylk3 UTSW 8 85352866 missense probably benign 0.26
R5276:Mylk3 UTSW 8 85355442 missense probably damaging 1.00
R5303:Mylk3 UTSW 8 85350476 missense probably damaging 1.00
R5338:Mylk3 UTSW 8 85342721 missense probably damaging 1.00
R5957:Mylk3 UTSW 8 85328637 missense probably damaging 0.98
R6021:Mylk3 UTSW 8 85364813 missense possibly damaging 0.92
R6294:Mylk3 UTSW 8 85350383 missense probably damaging 1.00
R6305:Mylk3 UTSW 8 85350419 missense probably damaging 1.00
R6376:Mylk3 UTSW 8 85358942 missense possibly damaging 0.53
R6970:Mylk3 UTSW 8 85359263 missense probably damaging 0.97
R7081:Mylk3 UTSW 8 85364793 missense probably benign 0.10
R7170:Mylk3 UTSW 8 85350485 missense probably damaging 1.00
R7318:Mylk3 UTSW 8 85359097 missense probably benign
R7422:Mylk3 UTSW 8 85355244 missense probably benign 0.16
R7503:Mylk3 UTSW 8 85353589 missense probably benign 0.00
R7536:Mylk3 UTSW 8 85353604 missense probably benign 0.05
Z1176:Mylk3 UTSW 8 85365179
Z1177:Mylk3 UTSW 8 85359194 missense probably benign 0.14
Z1177:Mylk3 UTSW 8 85365179
Predicted Primers PCR Primer
(F):5'- CAGCTTCAGTTCTTCCTGGG -3'
(R):5'- ATCCTTGTTTTGAACCTCAGGAC -3'

Sequencing Primer
(F):5'- TGGTCCTTCCCAGGCTCAG -3'
(R):5'- TGAACCTCAGGACCGTATTTC -3'
Posted On2016-07-22