Incidental Mutation 'R5296:Slc26a6'
ID405424
Institutional Source Beutler Lab
Gene Symbol Slc26a6
Ensembl Gene ENSMUSG00000023259
Gene Namesolute carrier family 26, member 6
SynonymsPat1, B930010B04Rik, CFEX
MMRRC Submission 042879-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.101) question?
Stock #R5296 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location108853283-108913049 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 108860646 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 526 (T526M)
Ref Sequence ENSEMBL: ENSMUSP00000095979 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098376] [ENSMUST00000188557] [ENSMUST00000192507] [ENSMUST00000192559] [ENSMUST00000193291] [ENSMUST00000193874]
Predicted Effect probably damaging
Transcript: ENSMUST00000098376
AA Change: T526M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000095979
Gene: ENSMUSG00000023259
AA Change: T526M

DomainStartEndE-ValueType
Pfam:Sulfate_transp 69 458 4.4e-113 PFAM
low complexity region 471 484 N/A INTRINSIC
PDB:3LLO|A 489 546 2e-16 PDB
low complexity region 554 593 N/A INTRINSIC
low complexity region 638 650 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000188557
AA Change: T526M

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000140849
Gene: ENSMUSG00000023259
AA Change: T526M

DomainStartEndE-ValueType
Pfam:Sulfate_tra_GLY 54 137 4.1e-33 PFAM
Pfam:Sulfate_transp 176 454 1.9e-67 PFAM
low complexity region 471 484 N/A INTRINSIC
PDB:3LLO|A 489 546 6e-16 PDB
low complexity region 554 593 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000192507
AA Change: T526M

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000141336
Gene: ENSMUSG00000023259
AA Change: T526M

DomainStartEndE-ValueType
Pfam:Sulfate_tra_GLY 54 137 4.1e-33 PFAM
Pfam:Sulfate_transp 176 454 1.9e-67 PFAM
low complexity region 471 484 N/A INTRINSIC
PDB:3LLO|A 489 546 6e-16 PDB
low complexity region 554 593 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192559
SMART Domains Protein: ENSMUSP00000141632
Gene: ENSMUSG00000023259

DomainStartEndE-ValueType
Pfam:Sulfate_tra_GLY 54 137 7.7e-34 PFAM
Pfam:Sulfate_transp 176 225 1.8e-5 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000193291
AA Change: T526M

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000142250
Gene: ENSMUSG00000023259
AA Change: T526M

DomainStartEndE-ValueType
Pfam:Sulfate_tra_GLY 54 137 4.1e-33 PFAM
Pfam:Sulfate_transp 176 454 1.9e-67 PFAM
low complexity region 471 484 N/A INTRINSIC
PDB:3LLO|A 489 546 6e-16 PDB
low complexity region 554 593 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193463
Predicted Effect probably benign
Transcript: ENSMUST00000193874
SMART Domains Protein: ENSMUSP00000141409
Gene: ENSMUSG00000023259

DomainStartEndE-ValueType
Pfam:Sulfate_tra_GLY 54 137 7.7e-34 PFAM
Pfam:Sulfate_transp 176 225 1.8e-5 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195646
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.9%
  • 10x: 97.9%
  • 20x: 96.6%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the solute carrier 26 family, whose members encode anion transporter proteins. This particular family member encodes a protein involved in transporting chloride, oxalate, sulfate and bicarbonate. Alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Aug 2013]
PHENOTYPE: Homozygous null mice display abnormal proximal tubule and duodenal anion exchange, but are otherwise normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apobr A C 7: 126,588,024 D89A probably damaging Het
Bhlhe41 C T 6: 145,862,968 probably benign Het
Cacna1s G A 1: 136,095,785 V674M probably benign Het
Cavin2 T C 1: 51,289,870 probably null Het
Cd300lb T C 11: 114,924,937 S106G possibly damaging Het
Ceacam15 A G 7: 16,673,196 V132A probably benign Het
Ddi2 G T 4: 141,684,765 Q279K probably benign Het
Dnah11 A G 12: 117,883,416 V4304A probably damaging Het
Dnah2 C T 11: 69,458,920 R2399Q probably benign Het
Dnase1l1 C T X: 74,277,038 probably null Het
Epsti1 T A 14: 77,904,650 H55Q probably benign Het
Flad1 T C 3: 89,411,196 T17A probably damaging Het
Fzd2 C T 11: 102,606,155 T475M probably damaging Het
Gemin5 C A 11: 58,130,061 W1099L probably damaging Het
Gm8979 A T 7: 106,081,848 noncoding transcript Het
Gm9892 T C 8: 52,196,929 noncoding transcript Het
Gmeb2 A G 2: 181,255,986 probably benign Het
Grip1 A G 10: 119,929,928 E55G probably damaging Het
Hltf T C 3: 20,108,112 S825P probably damaging Het
Kcnh3 A T 15: 99,241,939 Q902L probably null Het
Kcnt2 C T 1: 140,609,615 P1037L probably damaging Het
Klhl18 G C 9: 110,436,127 N335K possibly damaging Het
Lama5 A C 2: 180,193,801 L1253R probably damaging Het
Lancl2 T G 6: 57,724,582 S230A probably benign Het
Lmcd1 A G 6: 112,315,588 M134V probably damaging Het
Lrrc23 C A 6: 124,774,482 A205S probably damaging Het
Mfsd13b T A 7: 120,991,738 I234N probably damaging Het
Mroh3 A G 1: 136,196,323 S386P probably damaging Het
Mylk3 A C 8: 85,355,431 F313V possibly damaging Het
Myo9b A T 8: 71,333,388 Q643L possibly damaging Het
Nacad T C 11: 6,605,745 S2G unknown Het
Olfr1269 A T 2: 90,118,699 W300R probably damaging Het
Olfr136 C T 17: 38,335,456 Q100* probably null Het
Olfr419 G T 1: 174,250,756 T57K possibly damaging Het
Olfr908 T C 9: 38,516,116 F28S probably damaging Het
Pkd1 T C 17: 24,576,074 V2245A probably damaging Het
Pkdrej G A 15: 85,817,118 T1539I possibly damaging Het
Plch2 G T 4: 154,989,999 probably null Het
Pygm G A 19: 6,384,579 R34H probably damaging Het
Rgs12 T C 5: 35,021,104 probably benign Het
Ruvbl1 T C 6: 88,485,908 I338T probably damaging Het
Sapcd1 T A 17: 35,026,731 Q104L probably damaging Het
Satb2 T C 1: 56,796,907 E575G probably damaging Het
Sema6b T A 17: 56,127,091 probably null Het
Slc25a11 T C 11: 70,646,185 N15D probably damaging Het
Tcaf3 G T 6: 42,587,510 T906K possibly damaging Het
Thbd A T 2: 148,406,983 C322S probably damaging Het
Traf2 A G 2: 25,520,440 L399P probably damaging Het
Troap T A 15: 99,078,817 V274D probably damaging Het
Utrn G A 10: 12,401,355 T3406M probably damaging Het
Uts2 G T 4: 150,999,051 A40S possibly damaging Het
Vmn2r109 T A 17: 20,554,341 I251F possibly damaging Het
Vmn2r67 A G 7: 85,137,022 S592P probably damaging Het
Vps13b T G 15: 35,876,413 W2797G probably damaging Het
Ythdf1 A T 2: 180,912,188 M51K probably damaging Het
Zfp60 T A 7: 27,738,530 probably benign Het
Zfp882 T A 8: 71,914,360 F344I probably damaging Het
Other mutations in Slc26a6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00467:Slc26a6 APN 9 108855889 missense probably benign
IGL02447:Slc26a6 APN 9 108857052 missense probably benign 0.03
IGL03090:Slc26a6 APN 9 108860691 missense probably benign 0.06
R0018:Slc26a6 UTSW 9 108858922 splice site probably null
R0083:Slc26a6 UTSW 9 108859113 splice site probably null
R0133:Slc26a6 UTSW 9 108861323 missense possibly damaging 0.86
R0135:Slc26a6 UTSW 9 108860595 splice site probably benign
R0563:Slc26a6 UTSW 9 108857670 missense probably damaging 1.00
R0661:Slc26a6 UTSW 9 108859113 splice site probably null
R1513:Slc26a6 UTSW 9 108855836 missense probably benign 0.41
R1746:Slc26a6 UTSW 9 108861717 missense probably benign 0.00
R2079:Slc26a6 UTSW 9 108859058 missense probably damaging 0.97
R2939:Slc26a6 UTSW 9 108857037 missense probably benign 0.05
R2940:Slc26a6 UTSW 9 108857037 missense probably benign 0.05
R3833:Slc26a6 UTSW 9 108855918 missense possibly damaging 0.86
R3861:Slc26a6 UTSW 9 108854196 unclassified probably benign
R4175:Slc26a6 UTSW 9 108854217 unclassified probably benign
R4358:Slc26a6 UTSW 9 108861783 missense probably benign 0.00
R4403:Slc26a6 UTSW 9 108855938 missense probably benign
R4598:Slc26a6 UTSW 9 108856380 missense probably damaging 1.00
R4660:Slc26a6 UTSW 9 108861341 missense probably damaging 0.96
R4663:Slc26a6 UTSW 9 108857907 missense probably damaging 0.98
R5390:Slc26a6 UTSW 9 108861300 splice site probably benign
R5533:Slc26a6 UTSW 9 108857956 missense probably damaging 1.00
R5662:Slc26a6 UTSW 9 108859339 missense possibly damaging 0.94
R5845:Slc26a6 UTSW 9 108862083 missense possibly damaging 0.46
R6547:Slc26a6 UTSW 9 108860782 splice site probably null
R7079:Slc26a6 UTSW 9 108857948 missense probably damaging 1.00
R7652:Slc26a6 UTSW 9 108855944 critical splice donor site probably null
R8289:Slc26a6 UTSW 9 108856031 missense probably benign 0.00
R8290:Slc26a6 UTSW 9 108856031 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACTTTCGTAACACGGGGAGC -3'
(R):5'- TGATGAGGCGGTCAACATC -3'

Sequencing Primer
(F):5'- AGATGCAGCCAGGCTTAC -3'
(R):5'- TGATGAGGCGGTCAACATCTACAC -3'
Posted On2016-07-22