Mutagenetix > Incidental Mutations

Incidental Mutation 'R5296:Grip1'

405427

Institutional Source

Beutler Lab

Gene Symbol

Grip1

Ensembl Gene

ENSMUSG00000034813

Gene Name

glutamate receptor interacting protein 1

Synonyms

MMRRC Submission

042879-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5296 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

119453830-120087261 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 119929928 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 55 (E55G)

Ref Sequence

ENSEMBL: ENSMUSP00000122323 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041962] [ENSMUST00000077871] [ENSMUST00000105262] [ENSMUST00000138410] [ENSMUST00000144825] [ENSMUST00000144959] [ENSMUST00000147356] [ENSMUST00000147454] [ENSMUST00000148954]

Predicted Effect

probably damaging
Transcript: ENSMUST00000041962
AA Change: E56G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000042436
Gene: ENSMUSG00000034813
AA Change: E56G

Domain	Start	End	E-Value	Type
PDZ	63	137	4.86e-13	SMART
PDZ	161	239	6.4e-22	SMART
PDZ	262	337	1.97e-13	SMART
low complexity region	354	367	N/A	INTRINSIC
low complexity region	388	405	N/A	INTRINSIC
low complexity region	413	424	N/A	INTRINSIC
PDZ	429	509	6.36e-17	SMART
PDZ	530	606	1.11e-16	SMART
PDZ	629	703	1.73e-18	SMART
PDZ	947	1019	2.79e-13	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000077871
AA Change: E29G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000077033
Gene: ENSMUSG00000034813
AA Change: E29G

Domain	Start	End	E-Value	Type
PDZ	36	110	4.86e-13	SMART
PDZ	134	212	6.4e-22	SMART
PDZ	235	310	1.97e-13	SMART
low complexity region	327	340	N/A	INTRINSIC
low complexity region	361	378	N/A	INTRINSIC
low complexity region	386	397	N/A	INTRINSIC
PDZ	402	482	6.36e-17	SMART
PDZ	503	579	1.11e-16	SMART
PDZ	602	676	1.73e-18	SMART
PDZ	920	992	2.79e-13	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000105262
AA Change: E55G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000100897
Gene: ENSMUSG00000034813
AA Change: E55G

Domain	Start	End	E-Value	Type
PDZ	62	136	4.86e-13	SMART
PDZ	160	238	6.4e-22	SMART
PDZ	261	336	1.97e-13	SMART
low complexity region	353	366	N/A	INTRINSIC
low complexity region	387	404	N/A	INTRINSIC
low complexity region	412	423	N/A	INTRINSIC
PDZ	428	508	6.36e-17	SMART
PDZ	529	605	1.11e-16	SMART
PDZ	628	702	1.73e-18	SMART
PDZ	946	1018	2.79e-13	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127787

Predicted Effect

probably damaging
Transcript: ENSMUST00000138410
AA Change: E55G

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000123234
Gene: ENSMUSG00000034813
AA Change: E55G

Domain	Start	End	E-Value	Type
PDZ	62	136	4.86e-13	SMART
PDZ	160	238	6.4e-22	SMART
PDZ	261	336	1.97e-13	SMART
low complexity region	393	421	N/A	INTRINSIC
low complexity region	439	456	N/A	INTRINSIC
low complexity region	464	475	N/A	INTRINSIC
PDZ	480	560	6.36e-17	SMART
PDZ	581	657	1.11e-16	SMART
PDZ	680	754	1.73e-18	SMART
PDZ	1013	1085	2.79e-13	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000139352

Predicted Effect

probably benign
Transcript: ENSMUST00000144825
AA Change: E28G

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000121670
Gene: ENSMUSG00000034813
AA Change: E28G

Domain	Start	End	E-Value	Type
PDZ	35	109	4.86e-13	SMART
PDZ	133	211	6.4e-22	SMART
PDZ	234	309	1.97e-13	SMART
low complexity region	326	339	N/A	INTRINSIC
low complexity region	360	377	N/A	INTRINSIC
low complexity region	385	396	N/A	INTRINSIC
PDZ	401	481	6.36e-17	SMART
PDZ	502	578	1.11e-16	SMART
PDZ	601	675	1.73e-18	SMART
PDZ	919	991	2.79e-13	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000144959
AA Change: E55G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000122323
Gene: ENSMUSG00000034813
AA Change: E55G

Domain	Start	End	E-Value	Type
PDZ	62	136	4.86e-13	SMART
PDZ	160	238	6.4e-22	SMART
PDZ	261	336	1.97e-13	SMART
low complexity region	393	421	N/A	INTRINSIC
low complexity region	439	456	N/A	INTRINSIC
low complexity region	464	475	N/A	INTRINSIC
PDZ	480	560	6.36e-17	SMART
PDZ	581	657	1.11e-16	SMART
PDZ	680	754	1.73e-18	SMART
PDZ	998	1070	2.79e-13	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000147356
AA Change: E56G

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000115478
Gene: ENSMUSG00000034813
AA Change: E56G

Domain	Start	End	E-Value	Type
PDZ	63	137	4.86e-13	SMART
PDZ	161	239	6.4e-22	SMART
PDZ	262	337	1.97e-13	SMART
low complexity region	394	422	N/A	INTRINSIC
low complexity region	440	457	N/A	INTRINSIC
low complexity region	465	476	N/A	INTRINSIC
PDZ	481	561	6.36e-17	SMART
PDZ	582	658	1.11e-16	SMART
PDZ	681	755	1.73e-18	SMART
PDZ	999	1071	2.79e-13	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000147454
AA Change: E55G

PolyPhen 2 Score 0.887 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000118073
Gene: ENSMUSG00000034813
AA Change: E55G

Domain	Start	End	E-Value	Type
PDZ	62	136	4.86e-13	SMART
PDZ	160	238	6.4e-22	SMART
PDZ	261	336	1.97e-13	SMART
low complexity region	393	421	N/A	INTRINSIC
low complexity region	439	456	N/A	INTRINSIC
low complexity region	464	475	N/A	INTRINSIC
PDZ	480	560	6.36e-17	SMART
PDZ	581	657	1.11e-16	SMART
PDZ	680	754	1.73e-18	SMART
PDZ	998	1070	2.79e-13	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147598

Predicted Effect

probably benign
Transcript: ENSMUST00000148954
AA Change: E55G

PolyPhen 2 Score 0.288 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000118397
Gene: ENSMUSG00000034813
AA Change: E55G

Domain	Start	End	E-Value	Type
PDZ	62	136	4.86e-13	SMART
PDZ	160	238	6.4e-22	SMART
PDZ	261	336	1.97e-13	SMART
low complexity region	353	366	N/A	INTRINSIC
low complexity region	387	404	N/A	INTRINSIC
low complexity region	412	423	N/A	INTRINSIC
PDZ	428	508	6.36e-17	SMART
PDZ	529	605	1.11e-16	SMART
PDZ	628	702	1.73e-18	SMART
PDZ	961	1033	2.79e-13	SMART

Meta Mutation Damage Score

0.6642

Coding Region Coverage

1x: 99.5%
3x: 98.9%
10x: 97.9%
20x: 96.6%

Validation Efficiency

100% (65/65)

MGI Phenotype

FUNCTION: This gene encodes a protein containing multiple PDZ (post synaptic density protein, Drosophila disc large tumor suppressor, and zonula occludens-1 protein) domains. The encoded protein acts as a mediator between cytoskeletal and membrane proteins, particularly in neuronal cells, and facilitates complex formation at the cell membrane. Mutation of this gene can cause embryonic lethality resulting from defects of the dermo-epidermal junction. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2013]
PHENOTYPE: Homozygous ablation of gene function results in embryonic lethality and blistering skin lesions. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Apobr	A	C	7: 126,588,024	D89A	probably damaging	Het
Bhlhe41	C	T	6: 145,862,968		probably benign	Het
Cacna1s	G	A	1: 136,095,785	V674M	probably benign	Het
Cavin2	T	C	1: 51,289,870		probably null	Het
Cd300lb	T	C	11: 114,924,937	S106G	possibly damaging	Het
Ceacam15	A	G	7: 16,673,196	V132A	probably benign	Het
Ddi2	G	T	4: 141,684,765	Q279K	probably benign	Het
Dnah11	A	G	12: 117,883,416	V4304A	probably damaging	Het
Dnah2	C	T	11: 69,458,920	R2399Q	probably benign	Het
Dnase1l1	C	T	X: 74,277,038		probably null	Het
Epsti1	T	A	14: 77,904,650	H55Q	probably benign	Het
Flad1	T	C	3: 89,411,196	T17A	probably damaging	Het
Fzd2	C	T	11: 102,606,155	T475M	probably damaging	Het
Gemin5	C	A	11: 58,130,061	W1099L	probably damaging	Het
Gm8979	A	T	7: 106,081,848		noncoding transcript	Het
Gm9892	T	C	8: 52,196,929		noncoding transcript	Het
Gmeb2	A	G	2: 181,255,986		probably benign	Het
Hltf	T	C	3: 20,108,112	S825P	probably damaging	Het
Kcnh3	A	T	15: 99,241,939	Q902L	probably null	Het
Kcnt2	C	T	1: 140,609,615	P1037L	probably damaging	Het
Klhl18	G	C	9: 110,436,127	N335K	possibly damaging	Het
Lama5	A	C	2: 180,193,801	L1253R	probably damaging	Het
Lancl2	T	G	6: 57,724,582	S230A	probably benign	Het
Lmcd1	A	G	6: 112,315,588	M134V	probably damaging	Het
Lrrc23	C	A	6: 124,774,482	A205S	probably damaging	Het
Mfsd13b	T	A	7: 120,991,738	I234N	probably damaging	Het
Mroh3	A	G	1: 136,196,323	S386P	probably damaging	Het
Mylk3	A	C	8: 85,355,431	F313V	possibly damaging	Het
Myo9b	A	T	8: 71,333,388	Q643L	possibly damaging	Het
Nacad	T	C	11: 6,605,745	S2G	unknown	Het
Olfr1269	A	T	2: 90,118,699	W300R	probably damaging	Het
Olfr136	C	T	17: 38,335,456	Q100*	probably null	Het
Olfr419	G	T	1: 174,250,756	T57K	possibly damaging	Het
Olfr908	T	C	9: 38,516,116	F28S	probably damaging	Het
Pkd1	T	C	17: 24,576,074	V2245A	probably damaging	Het
Pkdrej	G	A	15: 85,817,118	T1539I	possibly damaging	Het
Plch2	G	T	4: 154,989,999		probably null	Het
Pygm	G	A	19: 6,384,579	R34H	probably damaging	Het
Rgs12	T	C	5: 35,021,104		probably benign	Het
Ruvbl1	T	C	6: 88,485,908	I338T	probably damaging	Het
Sapcd1	T	A	17: 35,026,731	Q104L	probably damaging	Het
Satb2	T	C	1: 56,796,907	E575G	probably damaging	Het
Sema6b	T	A	17: 56,127,091		probably null	Het
Slc25a11	T	C	11: 70,646,185	N15D	probably damaging	Het
Slc26a6	C	T	9: 108,860,646	T526M	probably damaging	Het
Tcaf3	G	T	6: 42,587,510	T906K	possibly damaging	Het
Thbd	A	T	2: 148,406,983	C322S	probably damaging	Het
Traf2	A	G	2: 25,520,440	L399P	probably damaging	Het
Troap	T	A	15: 99,078,817	V274D	probably damaging	Het
Utrn	G	A	10: 12,401,355	T3406M	probably damaging	Het
Uts2	G	T	4: 150,999,051	A40S	possibly damaging	Het
Vmn2r109	T	A	17: 20,554,341	I251F	possibly damaging	Het
Vmn2r67	A	G	7: 85,137,022	S592P	probably damaging	Het
Vps13b	T	G	15: 35,876,413	W2797G	probably damaging	Het
Ythdf1	A	T	2: 180,912,188	M51K	probably damaging	Het
Zfp60	T	A	7: 27,738,530		probably benign	Het
Zfp882	T	A	8: 71,914,360	F344I	probably damaging	Het

Other mutations in Grip1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01309:Grip1	APN	10	119931302	nonsense	probably null
IGL01374:Grip1	APN	10	120049368	missense	probably benign	0.03
IGL01592:Grip1	APN	10	119930003	missense	probably damaging	1.00
IGL02207:Grip1	APN	10	120075309	missense	probably damaging	1.00
IGL02222:Grip1	APN	10	119999809	missense	probably damaging	1.00
IGL02225:Grip1	APN	10	120049453	missense	probably damaging	1.00
IGL02447:Grip1	APN	10	120020071	missense	probably damaging	1.00
IGL02492:Grip1	APN	10	119930040	splice site	probably benign
IGL02522:Grip1	APN	10	119931249	missense	probably damaging	1.00
IGL02574:Grip1	APN	10	119942913	missense	probably damaging	1.00
IGL02718:Grip1	APN	10	120075515	makesense	probably null
IGL02751:Grip1	APN	10	119978577	missense	probably benign	0.08
IGL03221:Grip1	APN	10	119986394	missense	probably benign	0.00
IGL03377:Grip1	APN	10	120055032	missense	probably damaging	0.98
PIT4403001:Grip1	UTSW	10	119929928	missense	probably damaging	1.00
R0304:Grip1	UTSW	10	120075471	missense	probably benign	0.31
R0681:Grip1	UTSW	10	120010230	missense	probably damaging	1.00
R0760:Grip1	UTSW	10	120018078	missense	probably damaging	0.96
R1457:Grip1	UTSW	10	119986350	missense	possibly damaging	0.73
R1506:Grip1	UTSW	10	119978451	missense	probably damaging	1.00
R1541:Grip1	UTSW	10	120000543	missense	probably damaging	0.99
R1553:Grip1	UTSW	10	120054851	missense	probably damaging	1.00
R1709:Grip1	UTSW	10	119897715	missense	probably damaging	0.98
R2055:Grip1	UTSW	10	120049511	splice site	probably benign
R2059:Grip1	UTSW	10	120038698	missense	possibly damaging	0.80
R2261:Grip1	UTSW	10	119985584	missense	probably benign	0.00
R2475:Grip1	UTSW	10	119978496	missense	probably benign	0.01
R3777:Grip1	UTSW	10	119985630	critical splice donor site	probably null
R3849:Grip1	UTSW	10	119929958	missense	probably damaging	1.00
R3956:Grip1	UTSW	10	119930026	missense	probably damaging	1.00
R4643:Grip1	UTSW	10	120020101	missense	probably damaging	1.00
R4693:Grip1	UTSW	10	120000554	missense	probably benign	0.10
R4724:Grip1	UTSW	10	120038683	missense	probably benign	0.02
R4843:Grip1	UTSW	10	119930015	missense	probably damaging	1.00
R4884:Grip1	UTSW	10	120075306	missense	probably damaging	1.00
R4912:Grip1	UTSW	10	119931248	missense	probably damaging	1.00
R5185:Grip1	UTSW	10	119931259	missense	probably benign	0.37
R5291:Grip1	UTSW	10	120086969	missense	probably benign	0.04
R5293:Grip1	UTSW	10	119897735	missense	probably damaging	0.99
R5302:Grip1	UTSW	10	120020077	missense	probably damaging	1.00
R5541:Grip1	UTSW	10	120072718	missense	probably damaging	1.00
R5792:Grip1	UTSW	10	119985480	missense	probably benign	0.07
R5861:Grip1	UTSW	10	119929970	missense	probably damaging	1.00
R5905:Grip1	UTSW	10	119985492	missense	probably benign	0.02
R5949:Grip1	UTSW	10	120050242	missense	probably benign	0.00
R6112:Grip1	UTSW	10	119993232	missense	probably benign	0.00
R6166:Grip1	UTSW	10	120072718	missense	probably damaging	1.00
R6167:Grip1	UTSW	10	119897797	critical splice donor site	probably null
R6193:Grip1	UTSW	10	120038314	missense	probably damaging	1.00
R6218:Grip1	UTSW	10	119986346	missense	possibly damaging	0.95
R6267:Grip1	UTSW	10	120075464	nonsense	probably null
R6296:Grip1	UTSW	10	120075464	nonsense	probably null
R6490:Grip1	UTSW	10	119986424	missense	possibly damaging	0.82
R6543:Grip1	UTSW	10	119985594	missense	probably benign	0.00
R6558:Grip1	UTSW	10	119454383	missense	probably benign	0.00
R6995:Grip1	UTSW	10	119986470	missense	probably damaging	0.99
R7122:Grip1	UTSW	10	120035374	missense	possibly damaging	0.48
R7157:Grip1	UTSW	10	119945156	missense	probably damaging	1.00
R7410:Grip1	UTSW	10	120020020	missense	probably benign	0.01
R7447:Grip1	UTSW	10	120086966	missense	probably benign	0.01
R7539:Grip1	UTSW	10	120054871	missense	probably benign	0.17
R7586:Grip1	UTSW	10	120077138	splice site	probably null
R7768:Grip1	UTSW	10	120038397	missense	probably damaging	0.98
R7831:Grip1	UTSW	10	120018106	missense	probably damaging	1.00
R7896:Grip1	UTSW	10	119978545	missense	possibly damaging	0.53
R8103:Grip1	UTSW	10	119978535	missense	probably benign	0.00
R8254:Grip1	UTSW	10	120054905	nonsense	probably null
RF011:Grip1	UTSW	10	119931315	missense	probably null	0.97
Z1176:Grip1	UTSW	10	119819483	unclassified	probably benign
Z1177:Grip1	UTSW	10	119986444	missense	probably benign	0.06

Predicted Primers

PCR Primer
(F):5'- CGCCAGATGCTGCAATTAC -3'
(R):5'- GCGGGCAGCTGTCATTTATTTATC -3'

Sequencing Primer
(F):5'- CTGCAATTACAATACAAGCTGAGGTC -3'
(R):5'- AGTTACCTGGCAGCGATT -3'

Posted On

2016-07-22