Incidental Mutation 'R5296:Grip1'
ID405427
Institutional Source Beutler Lab
Gene Symbol Grip1
Ensembl Gene ENSMUSG00000034813
Gene Nameglutamate receptor interacting protein 1
Synonymseb
MMRRC Submission 042879-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5296 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location119453830-120087261 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 119929928 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 55 (E55G)
Ref Sequence ENSEMBL: ENSMUSP00000122323 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041962] [ENSMUST00000077871] [ENSMUST00000105262] [ENSMUST00000138410] [ENSMUST00000144825] [ENSMUST00000144959] [ENSMUST00000147356] [ENSMUST00000147454] [ENSMUST00000148954]
Predicted Effect probably damaging
Transcript: ENSMUST00000041962
AA Change: E56G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000042436
Gene: ENSMUSG00000034813
AA Change: E56G

DomainStartEndE-ValueType
PDZ 63 137 4.86e-13 SMART
PDZ 161 239 6.4e-22 SMART
PDZ 262 337 1.97e-13 SMART
low complexity region 354 367 N/A INTRINSIC
low complexity region 388 405 N/A INTRINSIC
low complexity region 413 424 N/A INTRINSIC
PDZ 429 509 6.36e-17 SMART
PDZ 530 606 1.11e-16 SMART
PDZ 629 703 1.73e-18 SMART
PDZ 947 1019 2.79e-13 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000077871
AA Change: E29G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000077033
Gene: ENSMUSG00000034813
AA Change: E29G

DomainStartEndE-ValueType
PDZ 36 110 4.86e-13 SMART
PDZ 134 212 6.4e-22 SMART
PDZ 235 310 1.97e-13 SMART
low complexity region 327 340 N/A INTRINSIC
low complexity region 361 378 N/A INTRINSIC
low complexity region 386 397 N/A INTRINSIC
PDZ 402 482 6.36e-17 SMART
PDZ 503 579 1.11e-16 SMART
PDZ 602 676 1.73e-18 SMART
PDZ 920 992 2.79e-13 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000105262
AA Change: E55G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000100897
Gene: ENSMUSG00000034813
AA Change: E55G

DomainStartEndE-ValueType
PDZ 62 136 4.86e-13 SMART
PDZ 160 238 6.4e-22 SMART
PDZ 261 336 1.97e-13 SMART
low complexity region 353 366 N/A INTRINSIC
low complexity region 387 404 N/A INTRINSIC
low complexity region 412 423 N/A INTRINSIC
PDZ 428 508 6.36e-17 SMART
PDZ 529 605 1.11e-16 SMART
PDZ 628 702 1.73e-18 SMART
PDZ 946 1018 2.79e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127787
Predicted Effect probably damaging
Transcript: ENSMUST00000138410
AA Change: E55G

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000123234
Gene: ENSMUSG00000034813
AA Change: E55G

DomainStartEndE-ValueType
PDZ 62 136 4.86e-13 SMART
PDZ 160 238 6.4e-22 SMART
PDZ 261 336 1.97e-13 SMART
low complexity region 393 421 N/A INTRINSIC
low complexity region 439 456 N/A INTRINSIC
low complexity region 464 475 N/A INTRINSIC
PDZ 480 560 6.36e-17 SMART
PDZ 581 657 1.11e-16 SMART
PDZ 680 754 1.73e-18 SMART
PDZ 1013 1085 2.79e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139352
Predicted Effect probably benign
Transcript: ENSMUST00000144825
AA Change: E28G

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000121670
Gene: ENSMUSG00000034813
AA Change: E28G

DomainStartEndE-ValueType
PDZ 35 109 4.86e-13 SMART
PDZ 133 211 6.4e-22 SMART
PDZ 234 309 1.97e-13 SMART
low complexity region 326 339 N/A INTRINSIC
low complexity region 360 377 N/A INTRINSIC
low complexity region 385 396 N/A INTRINSIC
PDZ 401 481 6.36e-17 SMART
PDZ 502 578 1.11e-16 SMART
PDZ 601 675 1.73e-18 SMART
PDZ 919 991 2.79e-13 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000144959
AA Change: E55G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122323
Gene: ENSMUSG00000034813
AA Change: E55G

DomainStartEndE-ValueType
PDZ 62 136 4.86e-13 SMART
PDZ 160 238 6.4e-22 SMART
PDZ 261 336 1.97e-13 SMART
low complexity region 393 421 N/A INTRINSIC
low complexity region 439 456 N/A INTRINSIC
low complexity region 464 475 N/A INTRINSIC
PDZ 480 560 6.36e-17 SMART
PDZ 581 657 1.11e-16 SMART
PDZ 680 754 1.73e-18 SMART
PDZ 998 1070 2.79e-13 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000147356
AA Change: E56G

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000115478
Gene: ENSMUSG00000034813
AA Change: E56G

DomainStartEndE-ValueType
PDZ 63 137 4.86e-13 SMART
PDZ 161 239 6.4e-22 SMART
PDZ 262 337 1.97e-13 SMART
low complexity region 394 422 N/A INTRINSIC
low complexity region 440 457 N/A INTRINSIC
low complexity region 465 476 N/A INTRINSIC
PDZ 481 561 6.36e-17 SMART
PDZ 582 658 1.11e-16 SMART
PDZ 681 755 1.73e-18 SMART
PDZ 999 1071 2.79e-13 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000147454
AA Change: E55G

PolyPhen 2 Score 0.887 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000118073
Gene: ENSMUSG00000034813
AA Change: E55G

DomainStartEndE-ValueType
PDZ 62 136 4.86e-13 SMART
PDZ 160 238 6.4e-22 SMART
PDZ 261 336 1.97e-13 SMART
low complexity region 393 421 N/A INTRINSIC
low complexity region 439 456 N/A INTRINSIC
low complexity region 464 475 N/A INTRINSIC
PDZ 480 560 6.36e-17 SMART
PDZ 581 657 1.11e-16 SMART
PDZ 680 754 1.73e-18 SMART
PDZ 998 1070 2.79e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147598
Predicted Effect probably benign
Transcript: ENSMUST00000148954
AA Change: E55G

PolyPhen 2 Score 0.288 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000118397
Gene: ENSMUSG00000034813
AA Change: E55G

DomainStartEndE-ValueType
PDZ 62 136 4.86e-13 SMART
PDZ 160 238 6.4e-22 SMART
PDZ 261 336 1.97e-13 SMART
low complexity region 353 366 N/A INTRINSIC
low complexity region 387 404 N/A INTRINSIC
low complexity region 412 423 N/A INTRINSIC
PDZ 428 508 6.36e-17 SMART
PDZ 529 605 1.11e-16 SMART
PDZ 628 702 1.73e-18 SMART
PDZ 961 1033 2.79e-13 SMART
Meta Mutation Damage Score 0.076 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.9%
  • 10x: 97.9%
  • 20x: 96.6%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: This gene encodes a protein containing multiple PDZ (post synaptic density protein, Drosophila disc large tumor suppressor, and zonula occludens-1 protein) domains. The encoded protein acts as a mediator between cytoskeletal and membrane proteins, particularly in neuronal cells, and facilitates complex formation at the cell membrane. Mutation of this gene can cause embryonic lethality resulting from defects of the dermo-epidermal junction. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2013]
PHENOTYPE: Homozygous ablation of gene function results in embryonic lethality and blistering skin lesions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apobr A C 7: 126,588,024 D89A probably damaging Het
Bhlhe41 C T 6: 145,862,968 probably benign Het
Cacna1s G A 1: 136,095,785 V674M probably benign Het
Cavin2 T C 1: 51,289,870 probably null Het
Cd300lb T C 11: 114,924,937 S106G possibly damaging Het
Ceacam15 A G 7: 16,673,196 V132A probably benign Het
Ddi2 G T 4: 141,684,765 Q279K probably benign Het
Dnah11 A G 12: 117,883,416 V4304A probably damaging Het
Dnah2 C T 11: 69,458,920 R2399Q probably benign Het
Dnase1l1 C T X: 74,277,038 probably null Het
Epsti1 T A 14: 77,904,650 H55Q probably benign Het
Flad1 T C 3: 89,411,196 T17A probably damaging Het
Fzd2 C T 11: 102,606,155 T475M probably damaging Het
Gemin5 C A 11: 58,130,061 W1099L probably damaging Het
Gm8979 A T 7: 106,081,848 noncoding transcript Het
Gm9892 T C 8: 52,196,929 noncoding transcript Het
Gmeb2 A G 2: 181,255,986 probably benign Het
Hltf T C 3: 20,108,112 S825P probably damaging Het
Kcnh3 A T 15: 99,241,939 Q902L probably null Het
Kcnt2 C T 1: 140,609,615 P1037L probably damaging Het
Klhl18 G C 9: 110,436,127 N335K possibly damaging Het
Lama5 A C 2: 180,193,801 L1253R probably damaging Het
Lancl2 T G 6: 57,724,582 S230A probably benign Het
Lmcd1 A G 6: 112,315,588 M134V probably damaging Het
Lrrc23 C A 6: 124,774,482 A205S probably damaging Het
Mfsd13b T A 7: 120,991,738 I234N probably damaging Het
Mroh3 A G 1: 136,196,323 S386P probably damaging Het
Mylk3 A C 8: 85,355,431 F313V possibly damaging Het
Myo9b A T 8: 71,333,388 Q643L possibly damaging Het
Nacad T C 11: 6,605,745 S2G unknown Het
Olfr1269 A T 2: 90,118,699 W300R probably damaging Het
Olfr136 C T 17: 38,335,456 Q100* probably null Het
Olfr419 G T 1: 174,250,756 T57K possibly damaging Het
Olfr908 T C 9: 38,516,116 F28S probably damaging Het
Pkd1 T C 17: 24,576,074 V2245A probably damaging Het
Pkdrej G A 15: 85,817,118 T1539I possibly damaging Het
Plch2 G T 4: 154,989,999 probably null Het
Pygm G A 19: 6,384,579 R34H probably damaging Het
Rgs12 T C 5: 35,021,104 probably benign Het
Ruvbl1 T C 6: 88,485,908 I338T probably damaging Het
Sapcd1 T A 17: 35,026,731 Q104L probably damaging Het
Satb2 T C 1: 56,796,907 E575G probably damaging Het
Sema6b T A 17: 56,127,091 probably null Het
Slc25a11 T C 11: 70,646,185 N15D probably damaging Het
Slc26a6 C T 9: 108,860,646 T526M probably damaging Het
Tcaf3 G T 6: 42,587,510 T906K possibly damaging Het
Thbd A T 2: 148,406,983 C322S probably damaging Het
Traf2 A G 2: 25,520,440 L399P probably damaging Het
Troap T A 15: 99,078,817 V274D probably damaging Het
Utrn G A 10: 12,401,355 T3406M probably damaging Het
Uts2 G T 4: 150,999,051 A40S possibly damaging Het
Vmn2r109 T A 17: 20,554,341 I251F possibly damaging Het
Vmn2r67 A G 7: 85,137,022 S592P probably damaging Het
Vps13b T G 15: 35,876,413 W2797G probably damaging Het
Ythdf1 A T 2: 180,912,188 M51K probably damaging Het
Zfp60 T A 7: 27,738,530 probably benign Het
Zfp882 T A 8: 71,914,360 F344I probably damaging Het
Other mutations in Grip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01309:Grip1 APN 10 119931302 nonsense probably null
IGL01374:Grip1 APN 10 120049368 missense probably benign 0.03
IGL01592:Grip1 APN 10 119930003 missense probably damaging 1.00
IGL02207:Grip1 APN 10 120075309 missense probably damaging 1.00
IGL02222:Grip1 APN 10 119999809 missense probably damaging 1.00
IGL02225:Grip1 APN 10 120049453 missense probably damaging 1.00
IGL02447:Grip1 APN 10 120020071 missense probably damaging 1.00
IGL02492:Grip1 APN 10 119930040 splice site probably benign
IGL02522:Grip1 APN 10 119931249 missense probably damaging 1.00
IGL02574:Grip1 APN 10 119942913 missense probably damaging 1.00
IGL02718:Grip1 APN 10 120075515 makesense probably null
IGL02751:Grip1 APN 10 119978577 missense probably benign 0.08
IGL03221:Grip1 APN 10 119986394 missense probably benign 0.00
IGL03377:Grip1 APN 10 120055032 missense probably damaging 0.98
PIT4403001:Grip1 UTSW 10 119929928 missense probably damaging 1.00
R0304:Grip1 UTSW 10 120075471 missense probably benign 0.31
R0681:Grip1 UTSW 10 120010230 missense probably damaging 1.00
R0760:Grip1 UTSW 10 120018078 missense probably damaging 0.96
R1457:Grip1 UTSW 10 119986350 missense possibly damaging 0.73
R1506:Grip1 UTSW 10 119978451 missense probably damaging 1.00
R1541:Grip1 UTSW 10 120000543 missense probably damaging 0.99
R1553:Grip1 UTSW 10 120054851 missense probably damaging 1.00
R1709:Grip1 UTSW 10 119897715 missense probably damaging 0.98
R2055:Grip1 UTSW 10 120049511 splice site probably benign
R2059:Grip1 UTSW 10 120038698 missense possibly damaging 0.80
R2261:Grip1 UTSW 10 119985584 missense probably benign 0.00
R2475:Grip1 UTSW 10 119978496 missense probably benign 0.01
R3777:Grip1 UTSW 10 119985630 critical splice donor site probably null
R3849:Grip1 UTSW 10 119929958 missense probably damaging 1.00
R3956:Grip1 UTSW 10 119930026 missense probably damaging 1.00
R4643:Grip1 UTSW 10 120020101 missense probably damaging 1.00
R4693:Grip1 UTSW 10 120000554 missense probably benign 0.10
R4724:Grip1 UTSW 10 120038683 missense probably benign 0.02
R4843:Grip1 UTSW 10 119930015 missense probably damaging 1.00
R4884:Grip1 UTSW 10 120075306 missense probably damaging 1.00
R4912:Grip1 UTSW 10 119931248 missense probably damaging 1.00
R5185:Grip1 UTSW 10 119931259 missense probably benign 0.37
R5291:Grip1 UTSW 10 120086969 missense probably benign 0.04
R5293:Grip1 UTSW 10 119897735 missense probably damaging 0.99
R5302:Grip1 UTSW 10 120020077 missense probably damaging 1.00
R5541:Grip1 UTSW 10 120072718 missense probably damaging 1.00
R5792:Grip1 UTSW 10 119985480 missense probably benign 0.07
R5861:Grip1 UTSW 10 119929970 missense probably damaging 1.00
R5905:Grip1 UTSW 10 119985492 missense probably benign 0.02
R5949:Grip1 UTSW 10 120050242 missense probably benign 0.00
R6112:Grip1 UTSW 10 119993232 missense probably benign 0.00
R6166:Grip1 UTSW 10 120072718 missense probably damaging 1.00
R6167:Grip1 UTSW 10 119897797 critical splice donor site probably null
R6193:Grip1 UTSW 10 120038314 missense probably damaging 1.00
R6218:Grip1 UTSW 10 119986346 missense possibly damaging 0.95
R6267:Grip1 UTSW 10 120075464 nonsense probably null
R6296:Grip1 UTSW 10 120075464 nonsense probably null
R6490:Grip1 UTSW 10 119986424 missense possibly damaging 0.82
R6543:Grip1 UTSW 10 119985594 missense probably benign 0.00
R6558:Grip1 UTSW 10 119454383 missense probably benign 0.00
R6995:Grip1 UTSW 10 119986470 missense probably damaging 0.99
R7122:Grip1 UTSW 10 120035374 missense possibly damaging 0.48
R7157:Grip1 UTSW 10 119945156 missense probably damaging 1.00
R7410:Grip1 UTSW 10 120020020 missense probably benign 0.01
R7447:Grip1 UTSW 10 120086966 missense probably benign 0.01
R7539:Grip1 UTSW 10 120054871 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- CGCCAGATGCTGCAATTAC -3'
(R):5'- GCGGGCAGCTGTCATTTATTTATC -3'

Sequencing Primer
(F):5'- CTGCAATTACAATACAAGCTGAGGTC -3'
(R):5'- AGTTACCTGGCAGCGATT -3'
Posted On2016-07-22