Mutagenetix > Incidental Mutation

Incidental Mutation 'R5296:Gemin5'

405429

Institutional Source

Beutler Lab

Gene Symbol

Gemin5

Ensembl Gene

ENSMUSG00000037275

Gene Name

gem nuclear organelle associated protein 5

Synonyms

MMRRC Submission

042879-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5296 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

58120002-58168539 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 58130061 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tryptophan to Leucine at position 1099 (W1099L)

Ref Sequence

ENSEMBL: ENSMUSP00000099772 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035604] [ENSMUST00000102711] [ENSMUST00000172035]

AlphaFold

Q8BX17

Predicted Effect

probably damaging
Transcript: ENSMUST00000035604
AA Change: W1100L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000036603
Gene: ENSMUSG00000037275
AA Change: W1100L

Domain	Start	End	E-Value	Type
WD40	53	95	1.47e-6	SMART
WD40	98	138	6.19e-1	SMART
WD40	141	180	1.54e0	SMART
WD40	184	255	2.45e-8	SMART
WD40	280	312	1.42e2	SMART
WD40	316	365	1.99e0	SMART
WD40	368	408	5.15e-2	SMART
WD40	415	455	8.49e-3	SMART
WD40	460	511	8.84e1	SMART
WD40	529	564	4.28e0	SMART
WD40	567	613	2.24e-2	SMART
WD40	628	668	2.2e-10	SMART
WD40	671	711	2.31e-4	SMART
low complexity region	731	754	N/A	INTRINSIC
low complexity region	788	804	N/A	INTRINSIC
low complexity region	813	844	N/A	INTRINSIC
low complexity region	1064	1084	N/A	INTRINSIC
low complexity region	1117	1132	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000102711
AA Change: W1099L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000099772
Gene: ENSMUSG00000037275
AA Change: W1099L

Domain	Start	End	E-Value	Type
WD40	53	95	1.47e-6	SMART
WD40	98	138	6.19e-1	SMART
WD40	141	180	1.54e0	SMART
WD40	184	255	2.45e-8	SMART
WD40	280	312	1.42e2	SMART
WD40	316	365	1.99e0	SMART
WD40	368	408	5.15e-2	SMART
WD40	415	455	8.49e-3	SMART
WD40	460	511	8.84e1	SMART
WD40	529	564	4.28e0	SMART
WD40	567	613	2.24e-2	SMART
WD40	628	668	2.2e-10	SMART
WD40	671	711	2.31e-4	SMART
low complexity region	731	754	N/A	INTRINSIC
low complexity region	788	804	N/A	INTRINSIC
low complexity region	813	844	N/A	INTRINSIC
low complexity region	1063	1083	N/A	INTRINSIC
low complexity region	1116	1131	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129126

Predicted Effect

probably damaging
Transcript: ENSMUST00000172035
AA Change: W1100L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000131842
Gene: ENSMUSG00000037275
AA Change: W1100L

Domain	Start	End	E-Value	Type
WD40	53	95	1.47e-6	SMART
WD40	98	138	6.19e-1	SMART
WD40	141	180	1.54e0	SMART
WD40	184	255	2.45e-8	SMART
WD40	280	312	1.42e2	SMART
WD40	316	365	1.99e0	SMART
WD40	368	408	5.15e-2	SMART
WD40	415	455	8.49e-3	SMART
WD40	460	511	8.84e1	SMART
WD40	529	564	4.28e0	SMART
WD40	567	613	2.24e-2	SMART
WD40	628	668	2.2e-10	SMART
WD40	671	711	2.31e-4	SMART
low complexity region	731	754	N/A	INTRINSIC
low complexity region	788	804	N/A	INTRINSIC
low complexity region	813	844	N/A	INTRINSIC
low complexity region	1064	1084	N/A	INTRINSIC
low complexity region	1117	1132	N/A	INTRINSIC

Meta Mutation Damage Score

0.4077

Coding Region Coverage

1x: 99.5%
3x: 98.9%
10x: 97.9%
20x: 96.6%

Validation Efficiency

100% (65/65)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a WD repeat protein that is a component of the survival of motor neurons (SMN) complex. The SMN complex plays a critical role in mRNA splicing through the assembly of spliceosomal small nuclear ribonucleoproteins (snRNPs), and may also mediate the assembly and transport of other classes of ribonucleoproteins. The encoded protein is the snRNA-binding component of the SMN complex. Dysregulation of this gene may play a role in alternative mRNA splicing and tumor cell motility. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2011]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Apobr	A	C	7: 126,588,024	D89A	probably damaging	Het
Bhlhe41	C	T	6: 145,862,968		probably benign	Het
Cacna1s	G	A	1: 136,095,785	V674M	probably benign	Het
Cavin2	T	C	1: 51,289,870		probably null	Het
Cd300lb	T	C	11: 114,924,937	S106G	possibly damaging	Het
Ceacam15	A	G	7: 16,673,196	V132A	probably benign	Het
Ddi2	G	T	4: 141,684,765	Q279K	probably benign	Het
Dnah11	A	G	12: 117,883,416	V4304A	probably damaging	Het
Dnah2	C	T	11: 69,458,920	R2399Q	probably benign	Het
Dnase1l1	C	T	X: 74,277,038		probably null	Het
Epsti1	T	A	14: 77,904,650	H55Q	probably benign	Het
Flad1	T	C	3: 89,411,196	T17A	probably damaging	Het
Fzd2	C	T	11: 102,606,155	T475M	probably damaging	Het
Gm8979	A	T	7: 106,081,848		noncoding transcript	Het
Gm9892	T	C	8: 52,196,929		noncoding transcript	Het
Gmeb2	A	G	2: 181,255,986		probably benign	Het
Grip1	A	G	10: 119,929,928	E55G	probably damaging	Het
Hltf	T	C	3: 20,108,112	S825P	probably damaging	Het
Kcnh3	A	T	15: 99,241,939	Q902L	probably null	Het
Kcnt2	C	T	1: 140,609,615	P1037L	probably damaging	Het
Klhl18	G	C	9: 110,436,127	N335K	possibly damaging	Het
Lama5	A	C	2: 180,193,801	L1253R	probably damaging	Het
Lancl2	T	G	6: 57,724,582	S230A	probably benign	Het
Lmcd1	A	G	6: 112,315,588	M134V	probably damaging	Het
Lrrc23	C	A	6: 124,774,482	A205S	probably damaging	Het
Mfsd13b	T	A	7: 120,991,738	I234N	probably damaging	Het
Mroh3	A	G	1: 136,196,323	S386P	probably damaging	Het
Mylk3	A	C	8: 85,355,431	F313V	possibly damaging	Het
Myo9b	A	T	8: 71,333,388	Q643L	possibly damaging	Het
Nacad	T	C	11: 6,605,745	S2G	unknown	Het
Olfr1269	A	T	2: 90,118,699	W300R	probably damaging	Het
Olfr136	C	T	17: 38,335,456	Q100*	probably null	Het
Olfr419	G	T	1: 174,250,756	T57K	possibly damaging	Het
Olfr908	T	C	9: 38,516,116	F28S	probably damaging	Het
Pkd1	T	C	17: 24,576,074	V2245A	probably damaging	Het
Pkdrej	G	A	15: 85,817,118	T1539I	possibly damaging	Het
Plch2	G	T	4: 154,989,999		probably null	Het
Pygm	G	A	19: 6,384,579	R34H	probably damaging	Het
Rgs12	T	C	5: 35,021,104		probably benign	Het
Ruvbl1	T	C	6: 88,485,908	I338T	probably damaging	Het
Sapcd1	T	A	17: 35,026,731	Q104L	probably damaging	Het
Satb2	T	C	1: 56,796,907	E575G	probably damaging	Het
Sema6b	T	A	17: 56,127,091		probably null	Het
Slc25a11	T	C	11: 70,646,185	N15D	probably damaging	Het
Slc26a6	C	T	9: 108,860,646	T526M	probably damaging	Het
Tcaf3	G	T	6: 42,587,510	T906K	possibly damaging	Het
Thbd	A	T	2: 148,406,983	C322S	probably damaging	Het
Traf2	A	G	2: 25,520,440	L399P	probably damaging	Het
Troap	T	A	15: 99,078,817	V274D	probably damaging	Het
Utrn	G	A	10: 12,401,355	T3406M	probably damaging	Het
Uts2	G	T	4: 150,999,051	A40S	possibly damaging	Het
Vmn2r109	T	A	17: 20,554,341	I251F	possibly damaging	Het
Vmn2r67	A	G	7: 85,137,022	S592P	probably damaging	Het
Vps13b	T	G	15: 35,876,413	W2797G	probably damaging	Het
Ythdf1	A	T	2: 180,912,188	M51K	probably damaging	Het
Zfp60	T	A	7: 27,738,530		probably benign	Het
Zfp882	T	A	8: 71,914,360	F344I	probably damaging	Het

Other mutations in Gemin5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00423:Gemin5	APN	11	58163817	missense	probably damaging	1.00
IGL00540:Gemin5	APN	11	58160818	missense	probably damaging	1.00
IGL01521:Gemin5	APN	11	58134918	splice site	probably benign
IGL02190:Gemin5	APN	11	58134842	missense	probably damaging	1.00
IGL02274:Gemin5	APN	11	58156795	missense	possibly damaging	0.80
IGL02494:Gemin5	APN	11	58121757	missense	probably benign	0.12
IGL02549:Gemin5	APN	11	58134803	missense	probably damaging	1.00
IGL02740:Gemin5	APN	11	58151564	missense	probably damaging	1.00
IGL02815:Gemin5	APN	11	58146409	missense	probably damaging	1.00
IGL02823:Gemin5	APN	11	58167705	splice site	probably benign
IGL02939:Gemin5	APN	11	58156730	missense	probably damaging	1.00
Landscape	UTSW	11	58163904	missense	probably benign	0.16
R0101:Gemin5	UTSW	11	58145496	missense	probably damaging	1.00
R0479:Gemin5	UTSW	11	58139551	missense	probably benign	0.00
R1481:Gemin5	UTSW	11	58141654	missense	probably damaging	1.00
R1642:Gemin5	UTSW	11	58139080	missense	probably damaging	1.00
R1648:Gemin5	UTSW	11	58147979	nonsense	probably null
R1980:Gemin5	UTSW	11	58136917	missense	probably damaging	1.00
R3079:Gemin5	UTSW	11	58145519	missense	probably damaging	1.00
R3418:Gemin5	UTSW	11	58156628	splice site	probably null
R4260:Gemin5	UTSW	11	58168359	missense	probably damaging	0.99
R4396:Gemin5	UTSW	11	58139549	missense	probably benign	0.05
R4902:Gemin5	UTSW	11	58164277	missense	probably benign	0.18
R5178:Gemin5	UTSW	11	58146518	missense	probably benign	0.01
R5350:Gemin5	UTSW	11	58141586	critical splice donor site	probably null
R5426:Gemin5	UTSW	11	58125287	missense	probably benign	0.00
R5494:Gemin5	UTSW	11	58130700	missense	probably damaging	1.00
R5744:Gemin5	UTSW	11	58155183	missense	possibly damaging	0.88
R5889:Gemin5	UTSW	11	58122355	missense	possibly damaging	0.76
R5984:Gemin5	UTSW	11	58156761	missense	probably damaging	1.00
R6844:Gemin5	UTSW	11	58163904	missense	probably benign	0.16
R6934:Gemin5	UTSW	11	58147912	missense	probably damaging	1.00
R6999:Gemin5	UTSW	11	58125121	missense	probably benign	0.00
R7015:Gemin5	UTSW	11	58156740	missense	probably damaging	1.00
R7144:Gemin5	UTSW	11	58141663	missense	probably benign	0.30
R7176:Gemin5	UTSW	11	58166002	missense	probably benign	0.05
R7540:Gemin5	UTSW	11	58130402	splice site	probably null
R7670:Gemin5	UTSW	11	58147928	missense	probably benign	0.01
R7717:Gemin5	UTSW	11	58151530	critical splice donor site	probably null
R7791:Gemin5	UTSW	11	58124993	missense	probably benign	0.04
R7981:Gemin5	UTSW	11	58145405	missense	probably damaging	1.00
R8050:Gemin5	UTSW	11	58128860	missense	probably benign	0.00
R8307:Gemin5	UTSW	11	58151594	missense	probably damaging	1.00
R8353:Gemin5	UTSW	11	58125239	missense	probably benign	0.00
R8371:Gemin5	UTSW	11	58126558	missense	probably benign
R8453:Gemin5	UTSW	11	58125239	missense	probably benign	0.00
R9181:Gemin5	UTSW	11	58130209	missense	probably benign	0.00
R9294:Gemin5	UTSW	11	58137748	missense	probably benign	0.08
R9400:Gemin5	UTSW	11	58137715	missense	probably damaging	1.00
R9672:Gemin5	UTSW	11	58167759	missense	probably benign	0.00
R9722:Gemin5	UTSW	11	58150592	missense	probably damaging	1.00
R9790:Gemin5	UTSW	11	58130020	nonsense	probably null
R9791:Gemin5	UTSW	11	58130020	nonsense	probably null
X0066:Gemin5	UTSW	11	58151535	missense	probably benign	0.02
Z1186:Gemin5	UTSW	11	58122289	missense	probably benign	0.03
Z1186:Gemin5	UTSW	11	58125218	missense	probably benign	0.00
Z1186:Gemin5	UTSW	11	58130071	missense	probably benign
Z1186:Gemin5	UTSW	11	58139510	missense	probably benign
Z1186:Gemin5	UTSW	11	58139575	missense	probably benign
Z1186:Gemin5	UTSW	11	58146519	missense	probably benign	0.03
Z1187:Gemin5	UTSW	11	58122289	missense	probably benign	0.03
Z1187:Gemin5	UTSW	11	58125218	missense	probably benign	0.00
Z1187:Gemin5	UTSW	11	58130071	missense	probably benign
Z1187:Gemin5	UTSW	11	58139510	missense	probably benign
Z1187:Gemin5	UTSW	11	58139575	missense	probably benign
Z1187:Gemin5	UTSW	11	58146519	missense	probably benign	0.03
Z1188:Gemin5	UTSW	11	58122289	missense	probably benign	0.03
Z1188:Gemin5	UTSW	11	58125218	missense	probably benign	0.00
Z1188:Gemin5	UTSW	11	58130071	missense	probably benign
Z1188:Gemin5	UTSW	11	58139510	missense	probably benign
Z1188:Gemin5	UTSW	11	58139575	missense	probably benign
Z1188:Gemin5	UTSW	11	58146519	missense	probably benign	0.03
Z1189:Gemin5	UTSW	11	58122289	missense	probably benign	0.03
Z1189:Gemin5	UTSW	11	58125218	missense	probably benign	0.00
Z1189:Gemin5	UTSW	11	58130071	missense	probably benign
Z1189:Gemin5	UTSW	11	58139510	missense	probably benign
Z1189:Gemin5	UTSW	11	58139575	missense	probably benign
Z1189:Gemin5	UTSW	11	58146519	missense	probably benign	0.03
Z1190:Gemin5	UTSW	11	58122289	missense	probably benign	0.03
Z1190:Gemin5	UTSW	11	58125218	missense	probably benign	0.00
Z1190:Gemin5	UTSW	11	58130071	missense	probably benign
Z1190:Gemin5	UTSW	11	58139510	missense	probably benign
Z1190:Gemin5	UTSW	11	58139575	missense	probably benign
Z1190:Gemin5	UTSW	11	58146519	missense	probably benign	0.03
Z1191:Gemin5	UTSW	11	58122289	missense	probably benign	0.03
Z1191:Gemin5	UTSW	11	58125218	missense	probably benign	0.00
Z1191:Gemin5	UTSW	11	58130071	missense	probably benign
Z1191:Gemin5	UTSW	11	58139510	missense	probably benign
Z1191:Gemin5	UTSW	11	58139575	missense	probably benign
Z1191:Gemin5	UTSW	11	58146519	missense	probably benign	0.03
Z1192:Gemin5	UTSW	11	58122289	missense	probably benign	0.03
Z1192:Gemin5	UTSW	11	58125218	missense	probably benign	0.00
Z1192:Gemin5	UTSW	11	58130071	missense	probably benign
Z1192:Gemin5	UTSW	11	58139510	missense	probably benign
Z1192:Gemin5	UTSW	11	58139575	missense	probably benign
Z1192:Gemin5	UTSW	11	58146519	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- ACTGTGAATACTGGGCTATCTC -3'
(R):5'- TGCCACAGCTACTTAGGAGC -3'

Sequencing Primer
(F):5'- GTGAATACTGGGCTATCTCTCACC -3'
(R):5'- AGCTACTTAGGAGCCACTTCCG -3'

Posted On

2016-07-22