Incidental Mutation 'R5296:Gemin5'
ID405429
Institutional Source Beutler Lab
Gene Symbol Gemin5
Ensembl Gene ENSMUSG00000037275
Gene Namegem nuclear organelle associated protein 5
Synonyms
MMRRC Submission 042879-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5296 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location58120002-58168539 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 58130061 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Leucine at position 1099 (W1099L)
Ref Sequence ENSEMBL: ENSMUSP00000099772 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035604] [ENSMUST00000102711] [ENSMUST00000172035]
Predicted Effect probably damaging
Transcript: ENSMUST00000035604
AA Change: W1100L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000036603
Gene: ENSMUSG00000037275
AA Change: W1100L

DomainStartEndE-ValueType
WD40 53 95 1.47e-6 SMART
WD40 98 138 6.19e-1 SMART
WD40 141 180 1.54e0 SMART
WD40 184 255 2.45e-8 SMART
WD40 280 312 1.42e2 SMART
WD40 316 365 1.99e0 SMART
WD40 368 408 5.15e-2 SMART
WD40 415 455 8.49e-3 SMART
WD40 460 511 8.84e1 SMART
WD40 529 564 4.28e0 SMART
WD40 567 613 2.24e-2 SMART
WD40 628 668 2.2e-10 SMART
WD40 671 711 2.31e-4 SMART
low complexity region 731 754 N/A INTRINSIC
low complexity region 788 804 N/A INTRINSIC
low complexity region 813 844 N/A INTRINSIC
low complexity region 1064 1084 N/A INTRINSIC
low complexity region 1117 1132 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000102711
AA Change: W1099L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099772
Gene: ENSMUSG00000037275
AA Change: W1099L

DomainStartEndE-ValueType
WD40 53 95 1.47e-6 SMART
WD40 98 138 6.19e-1 SMART
WD40 141 180 1.54e0 SMART
WD40 184 255 2.45e-8 SMART
WD40 280 312 1.42e2 SMART
WD40 316 365 1.99e0 SMART
WD40 368 408 5.15e-2 SMART
WD40 415 455 8.49e-3 SMART
WD40 460 511 8.84e1 SMART
WD40 529 564 4.28e0 SMART
WD40 567 613 2.24e-2 SMART
WD40 628 668 2.2e-10 SMART
WD40 671 711 2.31e-4 SMART
low complexity region 731 754 N/A INTRINSIC
low complexity region 788 804 N/A INTRINSIC
low complexity region 813 844 N/A INTRINSIC
low complexity region 1063 1083 N/A INTRINSIC
low complexity region 1116 1131 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129126
Predicted Effect probably damaging
Transcript: ENSMUST00000172035
AA Change: W1100L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000131842
Gene: ENSMUSG00000037275
AA Change: W1100L

DomainStartEndE-ValueType
WD40 53 95 1.47e-6 SMART
WD40 98 138 6.19e-1 SMART
WD40 141 180 1.54e0 SMART
WD40 184 255 2.45e-8 SMART
WD40 280 312 1.42e2 SMART
WD40 316 365 1.99e0 SMART
WD40 368 408 5.15e-2 SMART
WD40 415 455 8.49e-3 SMART
WD40 460 511 8.84e1 SMART
WD40 529 564 4.28e0 SMART
WD40 567 613 2.24e-2 SMART
WD40 628 668 2.2e-10 SMART
WD40 671 711 2.31e-4 SMART
low complexity region 731 754 N/A INTRINSIC
low complexity region 788 804 N/A INTRINSIC
low complexity region 813 844 N/A INTRINSIC
low complexity region 1064 1084 N/A INTRINSIC
low complexity region 1117 1132 N/A INTRINSIC
Meta Mutation Damage Score 0.4077 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.9%
  • 10x: 97.9%
  • 20x: 96.6%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a WD repeat protein that is a component of the survival of motor neurons (SMN) complex. The SMN complex plays a critical role in mRNA splicing through the assembly of spliceosomal small nuclear ribonucleoproteins (snRNPs), and may also mediate the assembly and transport of other classes of ribonucleoproteins. The encoded protein is the snRNA-binding component of the SMN complex. Dysregulation of this gene may play a role in alternative mRNA splicing and tumor cell motility. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2011]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apobr A C 7: 126,588,024 D89A probably damaging Het
Bhlhe41 C T 6: 145,862,968 probably benign Het
Cacna1s G A 1: 136,095,785 V674M probably benign Het
Cavin2 T C 1: 51,289,870 probably null Het
Cd300lb T C 11: 114,924,937 S106G possibly damaging Het
Ceacam15 A G 7: 16,673,196 V132A probably benign Het
Ddi2 G T 4: 141,684,765 Q279K probably benign Het
Dnah11 A G 12: 117,883,416 V4304A probably damaging Het
Dnah2 C T 11: 69,458,920 R2399Q probably benign Het
Dnase1l1 C T X: 74,277,038 probably null Het
Epsti1 T A 14: 77,904,650 H55Q probably benign Het
Flad1 T C 3: 89,411,196 T17A probably damaging Het
Fzd2 C T 11: 102,606,155 T475M probably damaging Het
Gm8979 A T 7: 106,081,848 noncoding transcript Het
Gm9892 T C 8: 52,196,929 noncoding transcript Het
Gmeb2 A G 2: 181,255,986 probably benign Het
Grip1 A G 10: 119,929,928 E55G probably damaging Het
Hltf T C 3: 20,108,112 S825P probably damaging Het
Kcnh3 A T 15: 99,241,939 Q902L probably null Het
Kcnt2 C T 1: 140,609,615 P1037L probably damaging Het
Klhl18 G C 9: 110,436,127 N335K possibly damaging Het
Lama5 A C 2: 180,193,801 L1253R probably damaging Het
Lancl2 T G 6: 57,724,582 S230A probably benign Het
Lmcd1 A G 6: 112,315,588 M134V probably damaging Het
Lrrc23 C A 6: 124,774,482 A205S probably damaging Het
Mfsd13b T A 7: 120,991,738 I234N probably damaging Het
Mroh3 A G 1: 136,196,323 S386P probably damaging Het
Mylk3 A C 8: 85,355,431 F313V possibly damaging Het
Myo9b A T 8: 71,333,388 Q643L possibly damaging Het
Nacad T C 11: 6,605,745 S2G unknown Het
Olfr1269 A T 2: 90,118,699 W300R probably damaging Het
Olfr136 C T 17: 38,335,456 Q100* probably null Het
Olfr419 G T 1: 174,250,756 T57K possibly damaging Het
Olfr908 T C 9: 38,516,116 F28S probably damaging Het
Pkd1 T C 17: 24,576,074 V2245A probably damaging Het
Pkdrej G A 15: 85,817,118 T1539I possibly damaging Het
Plch2 G T 4: 154,989,999 probably null Het
Pygm G A 19: 6,384,579 R34H probably damaging Het
Rgs12 T C 5: 35,021,104 probably benign Het
Ruvbl1 T C 6: 88,485,908 I338T probably damaging Het
Sapcd1 T A 17: 35,026,731 Q104L probably damaging Het
Satb2 T C 1: 56,796,907 E575G probably damaging Het
Sema6b T A 17: 56,127,091 probably null Het
Slc25a11 T C 11: 70,646,185 N15D probably damaging Het
Slc26a6 C T 9: 108,860,646 T526M probably damaging Het
Tcaf3 G T 6: 42,587,510 T906K possibly damaging Het
Thbd A T 2: 148,406,983 C322S probably damaging Het
Traf2 A G 2: 25,520,440 L399P probably damaging Het
Troap T A 15: 99,078,817 V274D probably damaging Het
Utrn G A 10: 12,401,355 T3406M probably damaging Het
Uts2 G T 4: 150,999,051 A40S possibly damaging Het
Vmn2r109 T A 17: 20,554,341 I251F possibly damaging Het
Vmn2r67 A G 7: 85,137,022 S592P probably damaging Het
Vps13b T G 15: 35,876,413 W2797G probably damaging Het
Ythdf1 A T 2: 180,912,188 M51K probably damaging Het
Zfp60 T A 7: 27,738,530 probably benign Het
Zfp882 T A 8: 71,914,360 F344I probably damaging Het
Other mutations in Gemin5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00423:Gemin5 APN 11 58163817 missense probably damaging 1.00
IGL00540:Gemin5 APN 11 58160818 missense probably damaging 1.00
IGL01521:Gemin5 APN 11 58134918 splice site probably benign
IGL02190:Gemin5 APN 11 58134842 missense probably damaging 1.00
IGL02274:Gemin5 APN 11 58156795 missense possibly damaging 0.80
IGL02494:Gemin5 APN 11 58121757 missense probably benign 0.12
IGL02549:Gemin5 APN 11 58134803 missense probably damaging 1.00
IGL02740:Gemin5 APN 11 58151564 missense probably damaging 1.00
IGL02815:Gemin5 APN 11 58146409 missense probably damaging 1.00
IGL02823:Gemin5 APN 11 58167705 splice site probably benign
IGL02939:Gemin5 APN 11 58156730 missense probably damaging 1.00
Landscape UTSW 11 58163904 missense probably benign 0.16
R0101:Gemin5 UTSW 11 58145496 missense probably damaging 1.00
R0479:Gemin5 UTSW 11 58139551 missense probably benign 0.00
R1481:Gemin5 UTSW 11 58141654 missense probably damaging 1.00
R1642:Gemin5 UTSW 11 58139080 missense probably damaging 1.00
R1648:Gemin5 UTSW 11 58147979 nonsense probably null
R1980:Gemin5 UTSW 11 58136917 missense probably damaging 1.00
R3079:Gemin5 UTSW 11 58145519 missense probably damaging 1.00
R3418:Gemin5 UTSW 11 58156628 intron probably null
R4260:Gemin5 UTSW 11 58168359 missense probably damaging 0.99
R4396:Gemin5 UTSW 11 58139549 missense probably benign 0.05
R4902:Gemin5 UTSW 11 58164277 missense probably benign 0.18
R5178:Gemin5 UTSW 11 58146518 missense probably benign 0.01
R5350:Gemin5 UTSW 11 58141586 critical splice donor site probably null
R5426:Gemin5 UTSW 11 58125287 missense probably benign 0.00
R5494:Gemin5 UTSW 11 58130700 missense probably damaging 1.00
R5744:Gemin5 UTSW 11 58155183 missense possibly damaging 0.88
R5889:Gemin5 UTSW 11 58122355 missense possibly damaging 0.76
R5984:Gemin5 UTSW 11 58156761 missense probably damaging 1.00
R6844:Gemin5 UTSW 11 58163904 missense probably benign 0.16
R6934:Gemin5 UTSW 11 58147912 missense probably damaging 1.00
R6999:Gemin5 UTSW 11 58125121 missense probably benign 0.00
R7015:Gemin5 UTSW 11 58156740 missense probably damaging 1.00
R7144:Gemin5 UTSW 11 58141663 missense probably benign 0.30
R7176:Gemin5 UTSW 11 58166002 missense probably benign 0.05
R7540:Gemin5 UTSW 11 58130402 intron probably null
R7670:Gemin5 UTSW 11 58147928 missense probably benign 0.01
R7717:Gemin5 UTSW 11 58151530 critical splice donor site probably null
R7791:Gemin5 UTSW 11 58124993 missense probably benign 0.04
R8050:Gemin5 UTSW 11 58128860 missense probably benign 0.00
X0066:Gemin5 UTSW 11 58151535 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- ACTGTGAATACTGGGCTATCTC -3'
(R):5'- TGCCACAGCTACTTAGGAGC -3'

Sequencing Primer
(F):5'- GTGAATACTGGGCTATCTCTCACC -3'
(R):5'- AGCTACTTAGGAGCCACTTCCG -3'
Posted On2016-07-22