Incidental Mutation 'R0497:Slc22a16'
ID 40543
Institutional Source Beutler Lab
Gene Symbol Slc22a16
Ensembl Gene ENSMUSG00000019834
Gene Name solute carrier family 22 (organic cation transporter), member 16
Synonyms OKB1, FLIPT2, OCT6, CT2, 4921504E14Rik
MMRRC Submission 038693-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.104) question?
Stock # R0497 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 40570336-40604132 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 40584967 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Arginine at position 255 (M255R)
Ref Sequence ENSEMBL: ENSMUSP00000077428 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019978] [ENSMUST00000078314]
AlphaFold Q497L8
Predicted Effect probably damaging
Transcript: ENSMUST00000019978
AA Change: M276R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000019978
Gene: ENSMUSG00000019834
AA Change: M276R

DomainStartEndE-ValueType
low complexity region 18 32 N/A INTRINSIC
transmembrane domain 38 60 N/A INTRINSIC
Pfam:Sugar_tr 136 556 6.4e-25 PFAM
Pfam:MFS_1 177 514 3.1e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000078314
AA Change: M255R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000077428
Gene: ENSMUSG00000019834
AA Change: M255R

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:Sugar_tr 114 535 5.1e-26 PFAM
Pfam:MFS_1 156 493 4.7e-20 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.7%
  • 10x: 96.6%
  • 20x: 93.1%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the organic zwitterion transporter protein family which transports carnitine. The encoded protein has also been shown to transport anticancer drugs like bleomycin (PMID: 20037140) successful treatment has been correlated with the level of activity of this transporter in tumor cells. [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik T A 7: 28,147,465 C1158S probably damaging Het
Aatk A C 11: 120,018,780 V110G probably damaging Het
Adcy6 A C 15: 98,597,725 probably null Het
Adm A G 7: 110,629,121 T170A probably benign Het
Afap1l2 G T 19: 56,930,209 N171K probably benign Het
Aph1b G T 9: 66,790,618 S112* probably null Het
Arhgap23 A G 11: 97,452,163 S424G probably damaging Het
Asah2 T A 19: 32,054,631 N46I probably benign Het
Braf G A 6: 39,640,549 probably benign Het
Brd2 C T 17: 34,114,360 R47Q probably damaging Het
C2cd5 A G 6: 143,012,093 V972A probably benign Het
Car9 T A 4: 43,511,881 L300H probably damaging Het
Chmp3 T C 6: 71,552,411 S20P probably damaging Het
Chp1 A G 2: 119,571,782 N79S possibly damaging Het
Cnot2 A T 10: 116,498,355 I335N probably damaging Het
Cntnap4 T C 8: 112,570,151 V6A probably benign Het
Ctcf T A 8: 105,675,040 probably benign Het
Dennd1b A G 1: 139,039,986 probably benign Het
Dirc2 A T 16: 35,735,604 V162D probably benign Het
Dnmbp A G 19: 43,856,640 probably benign Het
Eef2 T C 10: 81,181,586 F782L probably benign Het
Eogt T A 6: 97,135,233 Y153F probably benign Het
Fam81a G T 9: 70,096,119 Q237K possibly damaging Het
Fat2 T A 11: 55,283,402 T2162S probably benign Het
Gas6 T C 8: 13,470,387 I434V possibly damaging Het
Gm42417 A T 1: 36,532,167 L77Q probably damaging Het
Grik3 A T 4: 125,623,510 N49Y possibly damaging Het
Gucy2e A T 11: 69,224,159 V974E probably damaging Het
Helz2 A G 2: 181,229,656 V2721A probably damaging Het
Klhl6 GT G 16: 19,956,966 279 probably null Het
Krt73 A G 15: 101,802,230 L23P probably damaging Het
L3mbtl3 T C 10: 26,282,874 probably benign Het
Lrrc15 A T 16: 30,272,892 V543E probably damaging Het
Med13 G A 11: 86,276,983 probably benign Het
Med25 T C 7: 44,892,100 D60G probably damaging Het
Mgam T A 6: 40,664,892 Y560N probably damaging Het
Mlkl A G 8: 111,327,873 Y211H probably damaging Het
Msl2 A G 9: 101,101,294 N289S probably benign Het
Nwd2 G T 5: 63,806,343 W1090L probably damaging Het
Olfr1281 A G 2: 111,328,830 D137G probably benign Het
Omt2b T C 9: 78,328,231 probably benign Het
Pald1 A G 10: 61,341,315 L652P probably damaging Het
Pard3b T A 1: 62,440,008 probably null Het
Prdm15 G A 16: 97,794,334 T1098I possibly damaging Het
Rock2 A G 12: 16,954,953 T436A probably benign Het
Sema4c A T 1: 36,549,608 D812E probably benign Het
Sla A T 15: 66,792,249 I91K probably benign Het
Smg8 C T 11: 87,086,084 D224N possibly damaging Het
Spdef A T 17: 27,718,058 D190E probably benign Het
Taok1 A G 11: 77,573,804 I152T probably damaging Het
Tmem220 A G 11: 67,025,922 D36G probably damaging Het
Tmem235 A C 11: 117,864,351 I210L probably benign Het
Tmem266 C T 9: 55,380,884 probably null Het
Tmprss12 A G 15: 100,281,039 probably benign Het
Trim32 G A 4: 65,613,254 R16Q probably damaging Het
Usp38 T A 8: 80,984,424 probably benign Het
Usp44 C T 10: 93,846,806 P373S possibly damaging Het
Vmn1r209 G T 13: 22,805,948 Q191K probably damaging Het
Vmn1r70 T C 7: 10,634,026 I147T probably benign Het
Vmn2r107 T A 17: 20,375,132 I649N probably damaging Het
Vmn2r12 A T 5: 109,091,889 Y269* probably null Het
Zan C T 5: 137,412,676 probably benign Het
Zfp616 G T 11: 74,083,480 V192L probably benign Het
Zfp644 A T 5: 106,638,333 V116D probably damaging Het
Zgrf1 T C 3: 127,584,650 probably benign Het
Zhx3 A T 2: 160,779,994 L751* probably null Het
Znfx1 T A 2: 167,055,411 Q531L probably benign Het
Other mutations in Slc22a16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Slc22a16 APN 10 40595282 missense probably damaging 1.00
IGL00334:Slc22a16 APN 10 40573934 missense probably benign 0.03
IGL00757:Slc22a16 APN 10 40581327 missense probably damaging 1.00
IGL01082:Slc22a16 APN 10 40573864 missense probably benign 0.40
IGL01337:Slc22a16 APN 10 40595314 missense possibly damaging 0.51
IGL01389:Slc22a16 APN 10 40585135 missense probably damaging 1.00
IGL01405:Slc22a16 APN 10 40585195 missense probably benign 0.36
IGL01667:Slc22a16 APN 10 40585018 missense probably damaging 1.00
IGL01700:Slc22a16 APN 10 40603908 missense unknown
IGL01792:Slc22a16 APN 10 40573932 missense possibly damaging 0.51
IGL02948:Slc22a16 APN 10 40573962 nonsense probably null
IGL03178:Slc22a16 APN 10 40573760 missense probably benign 0.09
PIT4418001:Slc22a16 UTSW 10 40603825 missense unknown
R0358:Slc22a16 UTSW 10 40587492 splice site probably null
R0422:Slc22a16 UTSW 10 40591890 missense probably damaging 1.00
R1435:Slc22a16 UTSW 10 40587607 missense probably damaging 1.00
R1577:Slc22a16 UTSW 10 40603815 nonsense probably null
R1696:Slc22a16 UTSW 10 40584927 missense possibly damaging 0.75
R2022:Slc22a16 UTSW 10 40591877 missense probably damaging 1.00
R2065:Slc22a16 UTSW 10 40585020 missense possibly damaging 0.63
R2082:Slc22a16 UTSW 10 40585339 missense probably benign 0.02
R4083:Slc22a16 UTSW 10 40574069 missense probably damaging 1.00
R4588:Slc22a16 UTSW 10 40570681 intron probably benign
R4828:Slc22a16 UTSW 10 40573640 missense probably damaging 1.00
R4853:Slc22a16 UTSW 10 40574051 missense probably damaging 0.98
R5127:Slc22a16 UTSW 10 40573957 missense probably benign 0.21
R5215:Slc22a16 UTSW 10 40581390 missense probably damaging 1.00
R5590:Slc22a16 UTSW 10 40581341 missense possibly damaging 0.94
R5626:Slc22a16 UTSW 10 40584853 critical splice acceptor site probably null
R5810:Slc22a16 UTSW 10 40595318 missense possibly damaging 0.86
R6675:Slc22a16 UTSW 10 40573840 nonsense probably null
R6692:Slc22a16 UTSW 10 40603905 missense unknown
R6738:Slc22a16 UTSW 10 40585302 missense probably damaging 0.99
R7158:Slc22a16 UTSW 10 40573741 missense possibly damaging 0.66
R7685:Slc22a16 UTSW 10 40574089 missense possibly damaging 0.73
R7883:Slc22a16 UTSW 10 40603664 missense probably benign 0.01
R8332:Slc22a16 UTSW 10 40573745 missense possibly damaging 0.94
R8733:Slc22a16 UTSW 10 40574065 missense probably benign 0.16
R9321:Slc22a16 UTSW 10 40574051 missense probably damaging 0.98
R9548:Slc22a16 UTSW 10 40584869 nonsense probably null
RF004:Slc22a16 UTSW 10 40603646 missense possibly damaging 0.94
Z1177:Slc22a16 UTSW 10 40585156 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGGACTCAGACCCCTCATTCGTAAC -3'
(R):5'- AGCCTGTGCTTCCTAATGCTGTG -3'

Sequencing Primer
(F):5'- ACTGTACCATCATTACTGAGTCG -3'
(R):5'- GGACCTCGTCACATCTAGTGATAAG -3'
Posted On 2013-05-23