Incidental Mutation 'R5296:Slc25a11'
ID 405431
Institutional Source Beutler Lab
Gene Symbol Slc25a11
Ensembl Gene ENSMUSG00000014606
Gene Name solute carrier family 25 (mitochondrial carrier oxoglutarate carrier), member 11
Synonyms 2310022P18Rik, 2oxoc
MMRRC Submission 042879-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.826) question?
Stock # R5296 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 70535022-70538305 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 70537011 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Aspartic acid at position 15 (N15D)
Ref Sequence ENSEMBL: ENSMUSP00000120900 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014750] [ENSMUST00000037534] [ENSMUST00000055184] [ENSMUST00000108551] [ENSMUST00000136383] [ENSMUST00000139638] [ENSMUST00000152160] [ENSMUST00000141695]
AlphaFold Q9CR62
Predicted Effect possibly damaging
Transcript: ENSMUST00000014750
AA Change: N47D

PolyPhen 2 Score 0.761 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000014750
Gene: ENSMUSG00000014606
AA Change: N47D

DomainStartEndE-ValueType
Pfam:Mito_carr 18 112 1.3e-22 PFAM
Pfam:Mito_carr 115 213 2.6e-19 PFAM
Pfam:Mito_carr 216 311 5.2e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000037534
SMART Domains Protein: ENSMUSP00000036472
Gene: ENSMUSG00000040746

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:PA 53 150 1.4e-14 PFAM
transmembrane domain 172 194 N/A INTRINSIC
RING 230 271 2.65e-9 SMART
low complexity region 278 303 N/A INTRINSIC
low complexity region 332 343 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000055184
SMART Domains Protein: ENSMUSP00000057563
Gene: ENSMUSG00000050675

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
LRRNT 19 51 1.66e-1 SMART
LRR 70 91 2.54e2 SMART
LRR 92 114 9.96e-1 SMART
LRR_TYP 115 138 1.56e-2 SMART
LRR_TYP 139 162 1.47e-3 SMART
LRR 163 186 1.89e-1 SMART
LRR 187 210 8.09e-1 SMART
LRRCT 221 281 2.53e-12 SMART
low complexity region 403 432 N/A INTRINSIC
low complexity region 446 530 N/A INTRINSIC
low complexity region 533 579 N/A INTRINSIC
transmembrane domain 612 634 N/A INTRINSIC
low complexity region 650 662 N/A INTRINSIC
PDB:2BP3|T 680 701 2e-6 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000108551
SMART Domains Protein: ENSMUSP00000104191
Gene: ENSMUSG00000050675

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
LRRNT 19 51 1.66e-1 SMART
LRR 70 91 2.54e2 SMART
LRR 92 114 9.96e-1 SMART
LRR_TYP 115 138 1.56e-2 SMART
LRR_TYP 139 162 1.47e-3 SMART
LRR 163 186 1.89e-1 SMART
LRR 187 210 8.09e-1 SMART
LRRCT 221 281 2.53e-12 SMART
low complexity region 403 432 N/A INTRINSIC
low complexity region 446 530 N/A INTRINSIC
low complexity region 533 579 N/A INTRINSIC
transmembrane domain 612 634 N/A INTRINSIC
low complexity region 650 662 N/A INTRINSIC
PDB:2BP3|T 680 701 2e-6 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131071
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134804
Predicted Effect probably damaging
Transcript: ENSMUST00000136383
AA Change: N15D

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000120900
Gene: ENSMUSG00000014606
AA Change: N15D

DomainStartEndE-ValueType
Pfam:Mito_carr 1 75 9.2e-18 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000139638
AA Change: N15D

PolyPhen 2 Score 0.878 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000114685
Gene: ENSMUSG00000014606
AA Change: N15D

DomainStartEndE-ValueType
Pfam:Mito_carr 1 80 7.4e-17 PFAM
Pfam:Mito_carr 83 181 1.1e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141237
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141537
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152458
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152276
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151034
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157076
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143313
Predicted Effect probably benign
Transcript: ENSMUST00000152160
SMART Domains Protein: ENSMUSP00000115057
Gene: ENSMUSG00000040746

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000141695
SMART Domains Protein: ENSMUSP00000121511
Gene: ENSMUSG00000040746

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Meta Mutation Damage Score 0.3751 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.9%
  • 10x: 97.9%
  • 20x: 96.6%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The oxoglutarate/malate carrier transports 2-oxoglutarate across the inner membranes of mitochondria in an electroneutral exchange for malate or other dicarboxylic acids (summary by Iacobazzi et al., 1992 [PubMed 1457818]).[supplied by OMIM, Jan 2011]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apobr A C 7: 126,187,196 (GRCm39) D89A probably damaging Het
Bhlhe41 C T 6: 145,808,694 (GRCm39) probably benign Het
Cacna1s G A 1: 136,023,523 (GRCm39) V674M probably benign Het
Cavin2 T C 1: 51,329,029 (GRCm39) probably null Het
Cd300lb T C 11: 114,815,763 (GRCm39) S106G possibly damaging Het
Ceacam15 A G 7: 16,407,121 (GRCm39) V132A probably benign Het
Ddi2 G T 4: 141,412,076 (GRCm39) Q279K probably benign Het
Dnah11 A G 12: 117,847,151 (GRCm39) V4304A probably damaging Het
Dnah2 C T 11: 69,349,746 (GRCm39) R2399Q probably benign Het
Dnase1l1 C T X: 73,320,644 (GRCm39) probably null Het
Epsti1 T A 14: 78,142,090 (GRCm39) H55Q probably benign Het
Flad1 T C 3: 89,318,503 (GRCm39) T17A probably damaging Het
Fzd2 C T 11: 102,496,981 (GRCm39) T475M probably damaging Het
Gemin5 C A 11: 58,020,887 (GRCm39) W1099L probably damaging Het
Gm9892 T C 8: 52,649,964 (GRCm39) noncoding transcript Het
Gmeb2 A G 2: 180,897,779 (GRCm39) probably benign Het
Grip1 A G 10: 119,765,833 (GRCm39) E55G probably damaging Het
Gvin-ps3 A T 7: 105,681,055 (GRCm39) noncoding transcript Het
Hltf T C 3: 20,162,276 (GRCm39) S825P probably damaging Het
Kcnh3 A T 15: 99,139,820 (GRCm39) Q902L probably null Het
Kcnt2 C T 1: 140,537,353 (GRCm39) P1037L probably damaging Het
Klhl18 G C 9: 110,265,195 (GRCm39) N335K possibly damaging Het
Lama5 A C 2: 179,835,594 (GRCm39) L1253R probably damaging Het
Lancl2 T G 6: 57,701,567 (GRCm39) S230A probably benign Het
Lmcd1 A G 6: 112,292,549 (GRCm39) M134V probably damaging Het
Lrrc23 C A 6: 124,751,445 (GRCm39) A205S probably damaging Het
Mfsd13b T A 7: 120,590,961 (GRCm39) I234N probably damaging Het
Mroh3 A G 1: 136,124,061 (GRCm39) S386P probably damaging Het
Mylk3 A C 8: 86,082,060 (GRCm39) F313V possibly damaging Het
Myo9b A T 8: 71,786,032 (GRCm39) Q643L possibly damaging Het
Nacad T C 11: 6,555,745 (GRCm39) S2G unknown Het
Olfr908 T C 9: 38,427,412 (GRCm39) F28S probably damaging Het
Or10z1 G T 1: 174,078,322 (GRCm39) T57K possibly damaging Het
Or2n1d C T 17: 38,646,347 (GRCm39) Q100* probably null Het
Or4x6 A T 2: 89,949,043 (GRCm39) W300R probably damaging Het
Pkd1 T C 17: 24,795,048 (GRCm39) V2245A probably damaging Het
Pkdrej G A 15: 85,701,319 (GRCm39) T1539I possibly damaging Het
Plch2 G T 4: 155,074,456 (GRCm39) probably null Het
Pygm G A 19: 6,434,609 (GRCm39) R34H probably damaging Het
Rgs12 T C 5: 35,178,448 (GRCm39) probably benign Het
Ruvbl1 T C 6: 88,462,890 (GRCm39) I338T probably damaging Het
Sapcd1 T A 17: 35,245,707 (GRCm39) Q104L probably damaging Het
Satb2 T C 1: 56,836,066 (GRCm39) E575G probably damaging Het
Sema6b T A 17: 56,434,091 (GRCm39) probably null Het
Slc26a6 C T 9: 108,737,845 (GRCm39) T526M probably damaging Het
Tcaf3 G T 6: 42,564,444 (GRCm39) T906K possibly damaging Het
Thbd A T 2: 148,248,903 (GRCm39) C322S probably damaging Het
Traf2 A G 2: 25,410,452 (GRCm39) L399P probably damaging Het
Troap T A 15: 98,976,698 (GRCm39) V274D probably damaging Het
Utrn G A 10: 12,277,099 (GRCm39) T3406M probably damaging Het
Uts2 G T 4: 151,083,508 (GRCm39) A40S possibly damaging Het
Vmn2r109 T A 17: 20,774,603 (GRCm39) I251F possibly damaging Het
Vmn2r67 A G 7: 84,786,230 (GRCm39) S592P probably damaging Het
Vps13b T G 15: 35,876,559 (GRCm39) W2797G probably damaging Het
Ythdf1 A T 2: 180,553,981 (GRCm39) M51K probably damaging Het
Zfp60 T A 7: 27,437,955 (GRCm39) probably benign Het
Zfp882 T A 8: 72,668,204 (GRCm39) F344I probably damaging Het
Other mutations in Slc25a11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03087:Slc25a11 APN 11 70,536,033 (GRCm39) missense probably benign 0.09
IGL03348:Slc25a11 APN 11 70,536,170 (GRCm39) unclassified probably benign
R0448:Slc25a11 UTSW 11 70,536,405 (GRCm39) missense probably benign 0.43
R1368:Slc25a11 UTSW 11 70,536,352 (GRCm39) splice site probably null
R1505:Slc25a11 UTSW 11 70,537,650 (GRCm39) missense probably benign
R1781:Slc25a11 UTSW 11 70,535,651 (GRCm39) missense probably benign 0.44
R1970:Slc25a11 UTSW 11 70,536,999 (GRCm39) missense probably benign 0.25
R2508:Slc25a11 UTSW 11 70,536,658 (GRCm39) missense possibly damaging 0.95
R4397:Slc25a11 UTSW 11 70,535,677 (GRCm39) missense probably benign 0.01
R4747:Slc25a11 UTSW 11 70,536,782 (GRCm39) missense possibly damaging 0.95
R5177:Slc25a11 UTSW 11 70,536,643 (GRCm39) missense probably damaging 1.00
R5243:Slc25a11 UTSW 11 70,536,924 (GRCm39) missense probably damaging 1.00
R5510:Slc25a11 UTSW 11 70,536,361 (GRCm39) missense probably damaging 1.00
R5662:Slc25a11 UTSW 11 70,536,245 (GRCm39) nonsense probably null
R5771:Slc25a11 UTSW 11 70,537,016 (GRCm39) missense probably damaging 0.97
R7287:Slc25a11 UTSW 11 70,536,181 (GRCm39) missense probably benign
R7799:Slc25a11 UTSW 11 70,536,005 (GRCm39) missense probably benign
R7860:Slc25a11 UTSW 11 70,536,005 (GRCm39) missense probably benign
R8694:Slc25a11 UTSW 11 70,535,630 (GRCm39) missense probably benign 0.04
Z1177:Slc25a11 UTSW 11 70,535,671 (GRCm39) missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- AGAAATGTCAGCACATCAGGC -3'
(R):5'- CTTACTGGGCAACTGGACTC -3'

Sequencing Primer
(F):5'- TGTCAGCACATCAGGCCAAGG -3'
(R):5'- GGCAACTGGACTCTTTTGC -3'
Posted On 2016-07-22