Mutagenetix > Incidental Mutation

Incidental Mutation 'R5296:Fzd2'

405432

Institutional Source

Beutler Lab

Gene Symbol

Fzd2

Ensembl Gene

ENSMUSG00000050288

Gene Name

frizzled class receptor 2

Synonyms

Mfz10a, Fz10, Mfz10

MMRRC Submission

042879-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.775) question?

Stock #

R5296 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

102604396-102608058 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 102606155 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Methionine at position 475 (T475M)

Ref Sequence

ENSEMBL: ENSMUSP00000091463 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000057893]

AlphaFold

Q9JIP6

Predicted Effect

probably damaging
Transcript: ENSMUST00000057893
AA Change: T475M

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000091463
Gene: ENSMUSG00000050288
AA Change: T475M

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
FRI	43	160	7.47e-74	SMART
low complexity region	176	195	N/A	INTRINSIC
Frizzled	239	563	3.32e-218	SMART

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.5%
3x: 98.9%
10x: 97.9%
20x: 96.6%

Validation Efficiency

100% (65/65)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This intronless gene is a member of the frizzled gene family. Members of this family encode seven-transmembrane domain proteins that are receptors for the wingless type MMTV integration site family of signaling proteins. This gene encodes a protein that is coupled to the beta-catenin canonical signaling pathway. Competition between the wingless-type MMTV integration site family, member 3A and wingless-type MMTV integration site family, member 5A gene products for binding of this protein is thought to regulate the beta-catenin-dependent and -independent pathways. [provided by RefSeq, Dec 2010]
PHENOTYPE: About 50% of mice homozygous for a reporter allele display a cleft palate and die as neonates; the remaining 50% survive exhibiting a variable degree of postnatal runting and reduced olfactory sensitivity to various odorants. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Apobr	A	C	7: 126,588,024	D89A	probably damaging	Het
Bhlhe41	C	T	6: 145,862,968		probably benign	Het
Cacna1s	G	A	1: 136,095,785	V674M	probably benign	Het
Cavin2	T	C	1: 51,289,870		probably null	Het
Cd300lb	T	C	11: 114,924,937	S106G	possibly damaging	Het
Ceacam15	A	G	7: 16,673,196	V132A	probably benign	Het
Ddi2	G	T	4: 141,684,765	Q279K	probably benign	Het
Dnah11	A	G	12: 117,883,416	V4304A	probably damaging	Het
Dnah2	C	T	11: 69,458,920	R2399Q	probably benign	Het
Dnase1l1	C	T	X: 74,277,038		probably null	Het
Epsti1	T	A	14: 77,904,650	H55Q	probably benign	Het
Flad1	T	C	3: 89,411,196	T17A	probably damaging	Het
Gemin5	C	A	11: 58,130,061	W1099L	probably damaging	Het
Gm8979	A	T	7: 106,081,848		noncoding transcript	Het
Gm9892	T	C	8: 52,196,929		noncoding transcript	Het
Gmeb2	A	G	2: 181,255,986		probably benign	Het
Grip1	A	G	10: 119,929,928	E55G	probably damaging	Het
Hltf	T	C	3: 20,108,112	S825P	probably damaging	Het
Kcnh3	A	T	15: 99,241,939	Q902L	probably null	Het
Kcnt2	C	T	1: 140,609,615	P1037L	probably damaging	Het
Klhl18	G	C	9: 110,436,127	N335K	possibly damaging	Het
Lama5	A	C	2: 180,193,801	L1253R	probably damaging	Het
Lancl2	T	G	6: 57,724,582	S230A	probably benign	Het
Lmcd1	A	G	6: 112,315,588	M134V	probably damaging	Het
Lrrc23	C	A	6: 124,774,482	A205S	probably damaging	Het
Mfsd13b	T	A	7: 120,991,738	I234N	probably damaging	Het
Mroh3	A	G	1: 136,196,323	S386P	probably damaging	Het
Mylk3	A	C	8: 85,355,431	F313V	possibly damaging	Het
Myo9b	A	T	8: 71,333,388	Q643L	possibly damaging	Het
Nacad	T	C	11: 6,605,745	S2G	unknown	Het
Olfr1269	A	T	2: 90,118,699	W300R	probably damaging	Het
Olfr136	C	T	17: 38,335,456	Q100*	probably null	Het
Olfr419	G	T	1: 174,250,756	T57K	possibly damaging	Het
Olfr908	T	C	9: 38,516,116	F28S	probably damaging	Het
Pkd1	T	C	17: 24,576,074	V2245A	probably damaging	Het
Pkdrej	G	A	15: 85,817,118	T1539I	possibly damaging	Het
Plch2	G	T	4: 154,989,999		probably null	Het
Pygm	G	A	19: 6,384,579	R34H	probably damaging	Het
Rgs12	T	C	5: 35,021,104		probably benign	Het
Ruvbl1	T	C	6: 88,485,908	I338T	probably damaging	Het
Sapcd1	T	A	17: 35,026,731	Q104L	probably damaging	Het
Satb2	T	C	1: 56,796,907	E575G	probably damaging	Het
Sema6b	T	A	17: 56,127,091		probably null	Het
Slc25a11	T	C	11: 70,646,185	N15D	probably damaging	Het
Slc26a6	C	T	9: 108,860,646	T526M	probably damaging	Het
Tcaf3	G	T	6: 42,587,510	T906K	possibly damaging	Het
Thbd	A	T	2: 148,406,983	C322S	probably damaging	Het
Traf2	A	G	2: 25,520,440	L399P	probably damaging	Het
Troap	T	A	15: 99,078,817	V274D	probably damaging	Het
Utrn	G	A	10: 12,401,355	T3406M	probably damaging	Het
Uts2	G	T	4: 150,999,051	A40S	possibly damaging	Het
Vmn2r109	T	A	17: 20,554,341	I251F	possibly damaging	Het
Vmn2r67	A	G	7: 85,137,022	S592P	probably damaging	Het
Vps13b	T	G	15: 35,876,413	W2797G	probably damaging	Het
Ythdf1	A	T	2: 180,912,188	M51K	probably damaging	Het
Zfp60	T	A	7: 27,738,530		probably benign	Het
Zfp882	T	A	8: 71,914,360	F344I	probably damaging	Het

Other mutations in Fzd2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01667:Fzd2	APN	11	102605782	missense	possibly damaging	0.94
IGL02034:Fzd2	APN	11	102604904	missense	probably damaging	1.00
IGL02035:Fzd2	APN	11	102606444	makesense	probably null
frowzy	UTSW	11	102605129	missense	probably damaging	1.00
PIT4585001:Fzd2	UTSW	11	102605747	missense	probably damaging	0.99
R0201:Fzd2	UTSW	11	102606122	missense	probably damaging	1.00
R1146:Fzd2	UTSW	11	102605380	missense	possibly damaging	0.76
R1146:Fzd2	UTSW	11	102605380	missense	possibly damaging	0.76
R1530:Fzd2	UTSW	11	102605308	missense	probably benign	0.00
R1589:Fzd2	UTSW	11	102606328	missense	probably benign	0.06
R1676:Fzd2	UTSW	11	102605881	missense	probably damaging	1.00
R2057:Fzd2	UTSW	11	102605933	missense	probably damaging	1.00
R2219:Fzd2	UTSW	11	102605423	missense	probably benign	0.01
R2410:Fzd2	UTSW	11	102605627	missense	possibly damaging	0.71
R5058:Fzd2	UTSW	11	102604807	missense	probably damaging	0.99
R5580:Fzd2	UTSW	11	102605839	missense	probably damaging	0.99
R5788:Fzd2	UTSW	11	102605467	missense	probably benign	0.03
R6104:Fzd2	UTSW	11	102606335	missense	probably damaging	1.00
R6452:Fzd2	UTSW	11	102604985	missense	probably damaging	1.00
R7454:Fzd2	UTSW	11	102605129	missense	probably damaging	1.00
R7774:Fzd2	UTSW	11	102605488	missense	possibly damaging	0.88
R9129:Fzd2	UTSW	11	102605639	missense	probably benign	0.06
R9246:Fzd2	UTSW	11	102605923	missense	possibly damaging	0.94
R9631:Fzd2	UTSW	11	102606090	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- ATCACCATCTTGGCCATGGG -3'
(R):5'- GATGAGCGTCATGAGGTATTTGATC -3'

Sequencing Primer
(F):5'- TTCGTGGGCCTCAATAGC -3'
(R):5'- ATCATGTAGACTGTGAAGTCGGGC -3'

Posted On

2016-07-22