Incidental Mutation 'R5296:Fzd2'
ID405432
Institutional Source Beutler Lab
Gene Symbol Fzd2
Ensembl Gene ENSMUSG00000050288
Gene Namefrizzled class receptor 2
SynonymsMfz10a, Fz10, Mfz10
MMRRC Submission 042879-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.400) question?
Stock #R5296 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location102604396-102608058 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 102606155 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 475 (T475M)
Ref Sequence ENSEMBL: ENSMUSP00000091463 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057893]
Predicted Effect probably damaging
Transcript: ENSMUST00000057893
AA Change: T475M

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000091463
Gene: ENSMUSG00000050288
AA Change: T475M

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
FRI 43 160 7.47e-74 SMART
low complexity region 176 195 N/A INTRINSIC
Frizzled 239 563 3.32e-218 SMART
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.9%
  • 10x: 97.9%
  • 20x: 96.6%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This intronless gene is a member of the frizzled gene family. Members of this family encode seven-transmembrane domain proteins that are receptors for the wingless type MMTV integration site family of signaling proteins. This gene encodes a protein that is coupled to the beta-catenin canonical signaling pathway. Competition between the wingless-type MMTV integration site family, member 3A and wingless-type MMTV integration site family, member 5A gene products for binding of this protein is thought to regulate the beta-catenin-dependent and -independent pathways. [provided by RefSeq, Dec 2010]
PHENOTYPE: About 50% of mice homozygous for a reporter allele display a cleft palate and die as neonates; the remaining 50% survive exhibiting a variable degree of postnatal runting and reduced olfactory sensitivity to various odorants. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apobr A C 7: 126,588,024 D89A probably damaging Het
Bhlhe41 C T 6: 145,862,968 probably benign Het
Cacna1s G A 1: 136,095,785 V674M probably benign Het
Cavin2 T C 1: 51,289,870 probably null Het
Cd300lb T C 11: 114,924,937 S106G possibly damaging Het
Ceacam15 A G 7: 16,673,196 V132A probably benign Het
Ddi2 G T 4: 141,684,765 Q279K probably benign Het
Dnah11 A G 12: 117,883,416 V4304A probably damaging Het
Dnah2 C T 11: 69,458,920 R2399Q probably benign Het
Dnase1l1 C T X: 74,277,038 probably null Het
Epsti1 T A 14: 77,904,650 H55Q probably benign Het
Flad1 T C 3: 89,411,196 T17A probably damaging Het
Gemin5 C A 11: 58,130,061 W1099L probably damaging Het
Gm8979 A T 7: 106,081,848 noncoding transcript Het
Gm9892 T C 8: 52,196,929 noncoding transcript Het
Gmeb2 A G 2: 181,255,986 probably benign Het
Grip1 A G 10: 119,929,928 E55G probably damaging Het
Hltf T C 3: 20,108,112 S825P probably damaging Het
Kcnh3 A T 15: 99,241,939 Q902L probably null Het
Kcnt2 C T 1: 140,609,615 P1037L probably damaging Het
Klhl18 G C 9: 110,436,127 N335K possibly damaging Het
Lama5 A C 2: 180,193,801 L1253R probably damaging Het
Lancl2 T G 6: 57,724,582 S230A probably benign Het
Lmcd1 A G 6: 112,315,588 M134V probably damaging Het
Lrrc23 C A 6: 124,774,482 A205S probably damaging Het
Mfsd13b T A 7: 120,991,738 I234N probably damaging Het
Mroh3 A G 1: 136,196,323 S386P probably damaging Het
Mylk3 A C 8: 85,355,431 F313V possibly damaging Het
Myo9b A T 8: 71,333,388 Q643L possibly damaging Het
Nacad T C 11: 6,605,745 S2G unknown Het
Olfr1269 A T 2: 90,118,699 W300R probably damaging Het
Olfr136 C T 17: 38,335,456 Q100* probably null Het
Olfr419 G T 1: 174,250,756 T57K possibly damaging Het
Olfr908 T C 9: 38,516,116 F28S probably damaging Het
Pkd1 T C 17: 24,576,074 V2245A probably damaging Het
Pkdrej G A 15: 85,817,118 T1539I possibly damaging Het
Plch2 G T 4: 154,989,999 probably null Het
Pygm G A 19: 6,384,579 R34H probably damaging Het
Rgs12 T C 5: 35,021,104 probably benign Het
Ruvbl1 T C 6: 88,485,908 I338T probably damaging Het
Sapcd1 T A 17: 35,026,731 Q104L probably damaging Het
Satb2 T C 1: 56,796,907 E575G probably damaging Het
Sema6b T A 17: 56,127,091 probably null Het
Slc25a11 T C 11: 70,646,185 N15D probably damaging Het
Slc26a6 C T 9: 108,860,646 T526M probably damaging Het
Tcaf3 G T 6: 42,587,510 T906K possibly damaging Het
Thbd A T 2: 148,406,983 C322S probably damaging Het
Traf2 A G 2: 25,520,440 L399P probably damaging Het
Troap T A 15: 99,078,817 V274D probably damaging Het
Utrn G A 10: 12,401,355 T3406M probably damaging Het
Uts2 G T 4: 150,999,051 A40S possibly damaging Het
Vmn2r109 T A 17: 20,554,341 I251F possibly damaging Het
Vmn2r67 A G 7: 85,137,022 S592P probably damaging Het
Vps13b T G 15: 35,876,413 W2797G probably damaging Het
Ythdf1 A T 2: 180,912,188 M51K probably damaging Het
Zfp60 T A 7: 27,738,530 probably benign Het
Zfp882 T A 8: 71,914,360 F344I probably damaging Het
Other mutations in Fzd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01667:Fzd2 APN 11 102605782 missense possibly damaging 0.94
IGL02034:Fzd2 APN 11 102604904 missense probably damaging 1.00
IGL02035:Fzd2 APN 11 102606444 makesense probably null
frowzy UTSW 11 102605129 missense probably damaging 1.00
PIT4585001:Fzd2 UTSW 11 102605747 missense probably damaging 0.99
R0201:Fzd2 UTSW 11 102606122 missense probably damaging 1.00
R1146:Fzd2 UTSW 11 102605380 missense possibly damaging 0.76
R1146:Fzd2 UTSW 11 102605380 missense possibly damaging 0.76
R1530:Fzd2 UTSW 11 102605308 missense probably benign 0.00
R1589:Fzd2 UTSW 11 102606328 missense probably benign 0.06
R1676:Fzd2 UTSW 11 102605881 missense probably damaging 1.00
R2057:Fzd2 UTSW 11 102605933 missense probably damaging 1.00
R2219:Fzd2 UTSW 11 102605423 missense probably benign 0.01
R2410:Fzd2 UTSW 11 102605627 missense possibly damaging 0.71
R5058:Fzd2 UTSW 11 102604807 missense probably damaging 0.99
R5580:Fzd2 UTSW 11 102605839 missense probably damaging 0.99
R5788:Fzd2 UTSW 11 102605467 missense probably benign 0.03
R6104:Fzd2 UTSW 11 102606335 missense probably damaging 1.00
R6452:Fzd2 UTSW 11 102604985 missense probably damaging 1.00
R7454:Fzd2 UTSW 11 102605129 missense probably damaging 1.00
R7774:Fzd2 UTSW 11 102605488 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- ATCACCATCTTGGCCATGGG -3'
(R):5'- GATGAGCGTCATGAGGTATTTGATC -3'

Sequencing Primer
(F):5'- TTCGTGGGCCTCAATAGC -3'
(R):5'- ATCATGTAGACTGTGAAGTCGGGC -3'
Posted On2016-07-22