Incidental Mutation 'R5296:Epsti1'
ID405435
Institutional Source Beutler Lab
Gene Symbol Epsti1
Ensembl Gene ENSMUSG00000022014
Gene Nameepithelial stromal interaction 1 (breast)
Synonyms5033415K03Rik, 2310046K10Rik, BRESI1
MMRRC Submission 042879-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R5296 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location77904239-78002657 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 77904650 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 55 (H55Q)
Ref Sequence ENSEMBL: ENSMUSP00000154502 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022591] [ENSMUST00000169978] [ENSMUST00000227903]
Predicted Effect probably benign
Transcript: ENSMUST00000022591
AA Change: H55Q

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000022591
Gene: ENSMUSG00000022014
AA Change: H55Q

DomainStartEndE-ValueType
coiled coil region 111 180 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169978
AA Change: H55Q

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000130138
Gene: ENSMUSG00000022014
AA Change: H55Q

DomainStartEndE-ValueType
coiled coil region 111 180 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000227903
AA Change: H55Q

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.9%
  • 10x: 97.9%
  • 20x: 96.6%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has been shown to promote tumor invasion and metastasis in some invasive cancer cells when overexpressed. Expression of this gene has been shown to be upregulated by direct binding of the Kruppel like factor 8 protein to promoter sequences. The translated protein interacts with the amino terminal region of the valosin containing protein gene product, resulting in the nuclear translocation of the nuclear factor kappa B subunit 1 gene product, and activation of target genes. Overexpression of this gene has been observed in some breast cancers and in some individuals with systemic lupus erythematosus (SLE). [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apobr A C 7: 126,588,024 D89A probably damaging Het
Bhlhe41 C T 6: 145,862,968 probably benign Het
Cacna1s G A 1: 136,095,785 V674M probably benign Het
Cavin2 T C 1: 51,289,870 probably null Het
Cd300lb T C 11: 114,924,937 S106G possibly damaging Het
Ceacam15 A G 7: 16,673,196 V132A probably benign Het
Ddi2 G T 4: 141,684,765 Q279K probably benign Het
Dnah11 A G 12: 117,883,416 V4304A probably damaging Het
Dnah2 C T 11: 69,458,920 R2399Q probably benign Het
Dnase1l1 C T X: 74,277,038 probably null Het
Flad1 T C 3: 89,411,196 T17A probably damaging Het
Fzd2 C T 11: 102,606,155 T475M probably damaging Het
Gemin5 C A 11: 58,130,061 W1099L probably damaging Het
Gm8979 A T 7: 106,081,848 noncoding transcript Het
Gm9892 T C 8: 52,196,929 noncoding transcript Het
Gmeb2 A G 2: 181,255,986 probably benign Het
Grip1 A G 10: 119,929,928 E55G probably damaging Het
Hltf T C 3: 20,108,112 S825P probably damaging Het
Kcnh3 A T 15: 99,241,939 Q902L probably null Het
Kcnt2 C T 1: 140,609,615 P1037L probably damaging Het
Klhl18 G C 9: 110,436,127 N335K possibly damaging Het
Lama5 A C 2: 180,193,801 L1253R probably damaging Het
Lancl2 T G 6: 57,724,582 S230A probably benign Het
Lmcd1 A G 6: 112,315,588 M134V probably damaging Het
Lrrc23 C A 6: 124,774,482 A205S probably damaging Het
Mfsd13b T A 7: 120,991,738 I234N probably damaging Het
Mroh3 A G 1: 136,196,323 S386P probably damaging Het
Mylk3 A C 8: 85,355,431 F313V possibly damaging Het
Myo9b A T 8: 71,333,388 Q643L possibly damaging Het
Nacad T C 11: 6,605,745 S2G unknown Het
Olfr1269 A T 2: 90,118,699 W300R probably damaging Het
Olfr136 C T 17: 38,335,456 Q100* probably null Het
Olfr419 G T 1: 174,250,756 T57K possibly damaging Het
Olfr908 T C 9: 38,516,116 F28S probably damaging Het
Pkd1 T C 17: 24,576,074 V2245A probably damaging Het
Pkdrej G A 15: 85,817,118 T1539I possibly damaging Het
Plch2 G T 4: 154,989,999 probably null Het
Pygm G A 19: 6,384,579 R34H probably damaging Het
Rgs12 T C 5: 35,021,104 probably benign Het
Ruvbl1 T C 6: 88,485,908 I338T probably damaging Het
Sapcd1 T A 17: 35,026,731 Q104L probably damaging Het
Satb2 T C 1: 56,796,907 E575G probably damaging Het
Sema6b T A 17: 56,127,091 probably null Het
Slc25a11 T C 11: 70,646,185 N15D probably damaging Het
Slc26a6 C T 9: 108,860,646 T526M probably damaging Het
Tcaf3 G T 6: 42,587,510 T906K possibly damaging Het
Thbd A T 2: 148,406,983 C322S probably damaging Het
Traf2 A G 2: 25,520,440 L399P probably damaging Het
Troap T A 15: 99,078,817 V274D probably damaging Het
Utrn G A 10: 12,401,355 T3406M probably damaging Het
Uts2 G T 4: 150,999,051 A40S possibly damaging Het
Vmn2r109 T A 17: 20,554,341 I251F possibly damaging Het
Vmn2r67 A G 7: 85,137,022 S592P probably damaging Het
Vps13b T G 15: 35,876,413 W2797G probably damaging Het
Ythdf1 A T 2: 180,912,188 M51K probably damaging Het
Zfp60 T A 7: 27,738,530 probably benign Het
Zfp882 T A 8: 71,914,360 F344I probably damaging Het
Other mutations in Epsti1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01787:Epsti1 APN 14 77972612 critical splice donor site probably null
IGL02749:Epsti1 APN 14 77939923 missense probably damaging 1.00
IGL03031:Epsti1 APN 14 77974581 missense probably benign 0.00
R0302:Epsti1 UTSW 14 77939926 missense probably damaging 0.97
R0605:Epsti1 UTSW 14 77927237 splice site probably benign
R0743:Epsti1 UTSW 14 77931275 missense probably damaging 1.00
R0884:Epsti1 UTSW 14 77931275 missense probably damaging 1.00
R1986:Epsti1 UTSW 14 77932233 critical splice donor site probably null
R3162:Epsti1 UTSW 14 77974513 splice site probably benign
R5118:Epsti1 UTSW 14 77986682 splice site probably null
R5392:Epsti1 UTSW 14 77986744 missense probably benign 0.00
R5664:Epsti1 UTSW 14 77963664 missense possibly damaging 0.73
R5948:Epsti1 UTSW 14 77939890 missense probably damaging 1.00
R6402:Epsti1 UTSW 14 77939878 missense probably damaging 0.98
R7494:Epsti1 UTSW 14 77928754 missense probably benign 0.10
R7520:Epsti1 UTSW 14 77963443 splice site probably null
R7671:Epsti1 UTSW 14 77904490 missense probably damaging 1.00
R8039:Epsti1 UTSW 14 77931301 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CCATGTACACCCGCAGTAAG -3'
(R):5'- AGTCTTAAGAATCAGTGGACTGGG -3'

Sequencing Primer
(F):5'- ACCCGCAGTAAGGTGGTG -3'
(R):5'- GTGAGAATCTGCTATAAAGGTCTGC -3'
Posted On2016-07-22