Incidental Mutation 'R5296:Troap'
ID405438
Institutional Source Beutler Lab
Gene Symbol Troap
Ensembl Gene ENSMUSG00000032783
Gene Nametrophinin associated protein
SynonymsE130301L11Rik, tastin
MMRRC Submission 042879-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock #R5296 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location99074575-99083409 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 99078817 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 274 (V274D)
Ref Sequence ENSEMBL: ENSMUSP00000155404 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039665] [ENSMUST00000230054]
Predicted Effect probably damaging
Transcript: ENSMUST00000039665
AA Change: V274D

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000035389
Gene: ENSMUSG00000032783
AA Change: V274D

DomainStartEndE-ValueType
low complexity region 232 246 N/A INTRINSIC
low complexity region 390 407 N/A INTRINSIC
low complexity region 468 479 N/A INTRINSIC
low complexity region 499 511 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183449
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229224
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229740
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230027
Predicted Effect probably damaging
Transcript: ENSMUST00000230054
AA Change: V274D

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230311
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230868
Meta Mutation Damage Score 0.1839 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.9%
  • 10x: 97.9%
  • 20x: 96.6%
Validation Efficiency 100% (65/65)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apobr A C 7: 126,588,024 D89A probably damaging Het
Bhlhe41 C T 6: 145,862,968 probably benign Het
Cacna1s G A 1: 136,095,785 V674M probably benign Het
Cavin2 T C 1: 51,289,870 probably null Het
Cd300lb T C 11: 114,924,937 S106G possibly damaging Het
Ceacam15 A G 7: 16,673,196 V132A probably benign Het
Ddi2 G T 4: 141,684,765 Q279K probably benign Het
Dnah11 A G 12: 117,883,416 V4304A probably damaging Het
Dnah2 C T 11: 69,458,920 R2399Q probably benign Het
Dnase1l1 C T X: 74,277,038 probably null Het
Epsti1 T A 14: 77,904,650 H55Q probably benign Het
Flad1 T C 3: 89,411,196 T17A probably damaging Het
Fzd2 C T 11: 102,606,155 T475M probably damaging Het
Gemin5 C A 11: 58,130,061 W1099L probably damaging Het
Gm8979 A T 7: 106,081,848 noncoding transcript Het
Gm9892 T C 8: 52,196,929 noncoding transcript Het
Gmeb2 A G 2: 181,255,986 probably benign Het
Grip1 A G 10: 119,929,928 E55G probably damaging Het
Hltf T C 3: 20,108,112 S825P probably damaging Het
Kcnh3 A T 15: 99,241,939 Q902L probably null Het
Kcnt2 C T 1: 140,609,615 P1037L probably damaging Het
Klhl18 G C 9: 110,436,127 N335K possibly damaging Het
Lama5 A C 2: 180,193,801 L1253R probably damaging Het
Lancl2 T G 6: 57,724,582 S230A probably benign Het
Lmcd1 A G 6: 112,315,588 M134V probably damaging Het
Lrrc23 C A 6: 124,774,482 A205S probably damaging Het
Mfsd13b T A 7: 120,991,738 I234N probably damaging Het
Mroh3 A G 1: 136,196,323 S386P probably damaging Het
Mylk3 A C 8: 85,355,431 F313V possibly damaging Het
Myo9b A T 8: 71,333,388 Q643L possibly damaging Het
Nacad T C 11: 6,605,745 S2G unknown Het
Olfr1269 A T 2: 90,118,699 W300R probably damaging Het
Olfr136 C T 17: 38,335,456 Q100* probably null Het
Olfr419 G T 1: 174,250,756 T57K possibly damaging Het
Olfr908 T C 9: 38,516,116 F28S probably damaging Het
Pkd1 T C 17: 24,576,074 V2245A probably damaging Het
Pkdrej G A 15: 85,817,118 T1539I possibly damaging Het
Plch2 G T 4: 154,989,999 probably null Het
Pygm G A 19: 6,384,579 R34H probably damaging Het
Rgs12 T C 5: 35,021,104 probably benign Het
Ruvbl1 T C 6: 88,485,908 I338T probably damaging Het
Sapcd1 T A 17: 35,026,731 Q104L probably damaging Het
Satb2 T C 1: 56,796,907 E575G probably damaging Het
Sema6b T A 17: 56,127,091 probably null Het
Slc25a11 T C 11: 70,646,185 N15D probably damaging Het
Slc26a6 C T 9: 108,860,646 T526M probably damaging Het
Tcaf3 G T 6: 42,587,510 T906K possibly damaging Het
Thbd A T 2: 148,406,983 C322S probably damaging Het
Traf2 A G 2: 25,520,440 L399P probably damaging Het
Utrn G A 10: 12,401,355 T3406M probably damaging Het
Uts2 G T 4: 150,999,051 A40S possibly damaging Het
Vmn2r109 T A 17: 20,554,341 I251F possibly damaging Het
Vmn2r67 A G 7: 85,137,022 S592P probably damaging Het
Vps13b T G 15: 35,876,413 W2797G probably damaging Het
Ythdf1 A T 2: 180,912,188 M51K probably damaging Het
Zfp60 T A 7: 27,738,530 probably benign Het
Zfp882 T A 8: 71,914,360 F344I probably damaging Het
Other mutations in Troap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01140:Troap APN 15 99082146 missense probably damaging 1.00
IGL01949:Troap APN 15 99081221 missense probably benign 0.08
IGL02468:Troap APN 15 99075361 missense possibly damaging 0.83
IGL02804:Troap APN 15 99077671 splice site probably null
IGL03224:Troap APN 15 99081877 missense probably benign
R0617:Troap UTSW 15 99082660 missense probably damaging 1.00
R1085:Troap UTSW 15 99082163 missense probably damaging 0.99
R1872:Troap UTSW 15 99075352 splice site probably benign
R1884:Troap UTSW 15 99077898 missense probably benign 0.00
R1937:Troap UTSW 15 99077388 missense probably damaging 1.00
R2063:Troap UTSW 15 99082463 missense probably benign 0.00
R2065:Troap UTSW 15 99082463 missense probably benign 0.00
R2066:Troap UTSW 15 99082463 missense probably benign 0.00
R2068:Troap UTSW 15 99082463 missense probably benign 0.00
R2087:Troap UTSW 15 99078817 missense possibly damaging 0.84
R2159:Troap UTSW 15 99077586 missense probably damaging 0.96
R4282:Troap UTSW 15 99078832 missense probably benign
R5557:Troap UTSW 15 99075794 missense possibly damaging 0.92
R5652:Troap UTSW 15 99082264 missense probably benign 0.00
R5764:Troap UTSW 15 99075419 missense probably damaging 1.00
R6891:Troap UTSW 15 99082688 missense possibly damaging 0.56
R8008:Troap UTSW 15 99075630 missense probably benign 0.00
RF012:Troap UTSW 15 99075400 missense probably benign 0.10
Z1177:Troap UTSW 15 99077577 missense probably null
Predicted Primers PCR Primer
(F):5'- CCACTTCCTGCAAGACAATGTC -3'
(R):5'- TTGGTCCCAACTCCAGCAAAAG -3'

Sequencing Primer
(F):5'- CCTGCAAGACAATGTCTACTGTG -3'
(R):5'- CCAAATACCCTGAGTCCCGGG -3'
Posted On2016-07-22