Incidental Mutation 'R5296:Sema6b'
ID 405444
Institutional Source Beutler Lab
Gene Symbol Sema6b
Ensembl Gene ENSMUSG00000001227
Gene Name sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6B
Synonyms Sema, Seman, semaZ, VIb
MMRRC Submission 042879-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.221) question?
Stock # R5296 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 56123085-56140343 bp(-) (GRCm38)
Type of Mutation critical splice acceptor site
DNA Base Change (assembly) T to A at 56127091 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000130985 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001256] [ENSMUST00000167545]
AlphaFold O54951
Predicted Effect probably null
Transcript: ENSMUST00000001256
SMART Domains Protein: ENSMUSP00000001256
Gene: ENSMUSG00000001227

DomainStartEndE-ValueType
low complexity region 13 21 N/A INTRINSIC
Sema 66 496 2.48e-177 SMART
PSI 527 581 4.09e-1 SMART
transmembrane domain 604 626 N/A INTRINSIC
low complexity region 655 685 N/A INTRINSIC
low complexity region 707 718 N/A INTRINSIC
low complexity region 739 760 N/A INTRINSIC
low complexity region 855 866 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000167545
SMART Domains Protein: ENSMUSP00000130985
Gene: ENSMUSG00000001227

DomainStartEndE-ValueType
low complexity region 13 21 N/A INTRINSIC
Sema 66 496 2.48e-177 SMART
PSI 527 581 4.09e-1 SMART
transmembrane domain 604 626 N/A INTRINSIC
low complexity region 655 685 N/A INTRINSIC
low complexity region 707 718 N/A INTRINSIC
low complexity region 739 760 N/A INTRINSIC
low complexity region 855 866 N/A INTRINSIC
Meta Mutation Damage Score 0.9490 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.9%
  • 10x: 97.9%
  • 20x: 96.6%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the semaphorin family, a group of proteins characterized by the presence of a conserved semaphorin (sema) domain. Whereas some semaphorins are transmembrane proteins, others are secreted. Semaphorins play a major role in axon guidance. The protein encoded by this gene may be involved in both peripheral and central nervous system development. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal mossy fiber and mossy cell axon projections, thickened suprapyramidal bundles, and elongated infrapyramydal bundles. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apobr A C 7: 126,588,024 D89A probably damaging Het
Bhlhe41 C T 6: 145,862,968 probably benign Het
Cacna1s G A 1: 136,095,785 V674M probably benign Het
Cavin2 T C 1: 51,289,870 probably null Het
Cd300lb T C 11: 114,924,937 S106G possibly damaging Het
Ceacam15 A G 7: 16,673,196 V132A probably benign Het
Ddi2 G T 4: 141,684,765 Q279K probably benign Het
Dnah11 A G 12: 117,883,416 V4304A probably damaging Het
Dnah2 C T 11: 69,458,920 R2399Q probably benign Het
Dnase1l1 C T X: 74,277,038 probably null Het
Epsti1 T A 14: 77,904,650 H55Q probably benign Het
Flad1 T C 3: 89,411,196 T17A probably damaging Het
Fzd2 C T 11: 102,606,155 T475M probably damaging Het
Gemin5 C A 11: 58,130,061 W1099L probably damaging Het
Gm8979 A T 7: 106,081,848 noncoding transcript Het
Gm9892 T C 8: 52,196,929 noncoding transcript Het
Gmeb2 A G 2: 181,255,986 probably benign Het
Grip1 A G 10: 119,929,928 E55G probably damaging Het
Hltf T C 3: 20,108,112 S825P probably damaging Het
Kcnh3 A T 15: 99,241,939 Q902L probably null Het
Kcnt2 C T 1: 140,609,615 P1037L probably damaging Het
Klhl18 G C 9: 110,436,127 N335K possibly damaging Het
Lama5 A C 2: 180,193,801 L1253R probably damaging Het
Lancl2 T G 6: 57,724,582 S230A probably benign Het
Lmcd1 A G 6: 112,315,588 M134V probably damaging Het
Lrrc23 C A 6: 124,774,482 A205S probably damaging Het
Mfsd13b T A 7: 120,991,738 I234N probably damaging Het
Mroh3 A G 1: 136,196,323 S386P probably damaging Het
Mylk3 A C 8: 85,355,431 F313V possibly damaging Het
Myo9b A T 8: 71,333,388 Q643L possibly damaging Het
Nacad T C 11: 6,605,745 S2G unknown Het
Olfr1269 A T 2: 90,118,699 W300R probably damaging Het
Olfr136 C T 17: 38,335,456 Q100* probably null Het
Olfr419 G T 1: 174,250,756 T57K possibly damaging Het
Olfr908 T C 9: 38,516,116 F28S probably damaging Het
Pkd1 T C 17: 24,576,074 V2245A probably damaging Het
Pkdrej G A 15: 85,817,118 T1539I possibly damaging Het
Plch2 G T 4: 154,989,999 probably null Het
Pygm G A 19: 6,384,579 R34H probably damaging Het
Rgs12 T C 5: 35,021,104 probably benign Het
Ruvbl1 T C 6: 88,485,908 I338T probably damaging Het
Sapcd1 T A 17: 35,026,731 Q104L probably damaging Het
Satb2 T C 1: 56,796,907 E575G probably damaging Het
Slc25a11 T C 11: 70,646,185 N15D probably damaging Het
Slc26a6 C T 9: 108,860,646 T526M probably damaging Het
Tcaf3 G T 6: 42,587,510 T906K possibly damaging Het
Thbd A T 2: 148,406,983 C322S probably damaging Het
Traf2 A G 2: 25,520,440 L399P probably damaging Het
Troap T A 15: 99,078,817 V274D probably damaging Het
Utrn G A 10: 12,401,355 T3406M probably damaging Het
Uts2 G T 4: 150,999,051 A40S possibly damaging Het
Vmn2r109 T A 17: 20,554,341 I251F possibly damaging Het
Vmn2r67 A G 7: 85,137,022 S592P probably damaging Het
Vps13b T G 15: 35,876,413 W2797G probably damaging Het
Ythdf1 A T 2: 180,912,188 M51K probably damaging Het
Zfp60 T A 7: 27,738,530 probably benign Het
Zfp882 T A 8: 71,914,360 F344I probably damaging Het
Other mutations in Sema6b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00324:Sema6b APN 17 56130048 missense probably damaging 1.00
IGL01102:Sema6b APN 17 56132761 missense possibly damaging 0.91
IGL01533:Sema6b APN 17 56129499 splice site probably benign
IGL01611:Sema6b APN 17 56129969 splice site probably null
IGL01996:Sema6b APN 17 56131157 missense probably damaging 1.00
IGL02118:Sema6b APN 17 56132821 missense probably benign
R0010:Sema6b UTSW 17 56124105 missense probably benign 0.06
R0066:Sema6b UTSW 17 56128271 missense possibly damaging 0.83
R0066:Sema6b UTSW 17 56128271 missense possibly damaging 0.83
R0525:Sema6b UTSW 17 56126630 missense probably damaging 0.96
R0635:Sema6b UTSW 17 56129971 critical splice donor site probably null
R1129:Sema6b UTSW 17 56124347 missense probably benign
R1927:Sema6b UTSW 17 56132797 missense probably benign 0.00
R2211:Sema6b UTSW 17 56124741 missense probably benign 0.00
R4081:Sema6b UTSW 17 56128307 missense probably damaging 0.99
R5013:Sema6b UTSW 17 56132497 critical splice donor site probably null
R5314:Sema6b UTSW 17 56128413 nonsense probably null
R6317:Sema6b UTSW 17 56124047 missense probably benign 0.26
R6419:Sema6b UTSW 17 56132784 nonsense probably null
R7255:Sema6b UTSW 17 56125336 missense probably benign 0.01
R7289:Sema6b UTSW 17 56125573 missense possibly damaging 0.77
R7805:Sema6b UTSW 17 56131555 missense probably damaging 1.00
R8157:Sema6b UTSW 17 56128448 missense probably damaging 1.00
R8290:Sema6b UTSW 17 56124803 missense possibly damaging 0.93
R8305:Sema6b UTSW 17 56127084 missense probably damaging 1.00
R9502:Sema6b UTSW 17 56132500 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- TGAAGTACTGGGATGCCCTC -3'
(R):5'- AAGTGTGGGCAAAGACCCTG -3'

Sequencing Primer
(F):5'- TCCTCCCCAGGACTGACC -3'
(R):5'- CCCTGGAGTAGAGGGCATG -3'
Posted On 2016-07-22