Incidental Mutation 'R5296:Dnase1l1'
ID 405447
Institutional Source Beutler Lab
Gene Symbol Dnase1l1
Ensembl Gene ENSMUSG00000019088
Gene Name deoxyribonuclease 1-like 1
Synonyms 2310005K03Rik, G4.8, Dnase1ll, Dnl1ll
MMRRC Submission 042879-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.062) question?
Stock # R5296 (G1)
Quality Score 222
Status Validated
Chromosome X
Chromosomal Location 73316823-73325939 bp(-) (GRCm39)
Type of Mutation critical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to T at 73320644 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000113515 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000008826] [ENSMUST00000019232] [ENSMUST00000074085] [ENSMUST00000075821] [ENSMUST00000114189] [ENSMUST00000119361] [ENSMUST00000135690] [ENSMUST00000151702]
AlphaFold Q9D7J6
Predicted Effect probably benign
Transcript: ENSMUST00000008826
SMART Domains Protein: ENSMUSP00000008826
Gene: ENSMUSG00000008682

DomainStartEndE-ValueType
Pfam:Ribosomal_L16 5 167 1.1e-34 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000019232
SMART Domains Protein: ENSMUSP00000019232
Gene: ENSMUSG00000019088

DomainStartEndE-ValueType
DNaseIc 21 289 3.93e-149 SMART
low complexity region 301 313 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000074085
SMART Domains Protein: ENSMUSP00000082055
Gene: ENSMUSG00000008682

DomainStartEndE-ValueType
Pfam:Ribosomal_L16 5 167 1.1e-34 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000075821
SMART Domains Protein: ENSMUSP00000075218
Gene: ENSMUSG00000019088

DomainStartEndE-ValueType
DNaseIc 21 289 3.93e-149 SMART
low complexity region 301 313 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083047
Predicted Effect probably null
Transcript: ENSMUST00000114189
SMART Domains Protein: ENSMUSP00000109827
Gene: ENSMUSG00000019088

DomainStartEndE-ValueType
Blast:DNaseIc 21 70 5e-22 BLAST
SCOP:d2dnja_ 39 79 2e-4 SMART
low complexity region 91 103 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000119361
SMART Domains Protein: ENSMUSP00000113515
Gene: ENSMUSG00000019088

DomainStartEndE-ValueType
Blast:DNaseIc 21 64 2e-22 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144434
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125775
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146584
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128763
Predicted Effect noncoding transcript
Transcript: ENSMUST00000121868
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146260
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138954
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135012
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134330
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142142
Predicted Effect probably benign
Transcript: ENSMUST00000135690
SMART Domains Protein: ENSMUSP00000119500
Gene: ENSMUSG00000008682

DomainStartEndE-ValueType
Pfam:Ribosomal_L16 5 150 1.2e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184075
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148882
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149171
Predicted Effect probably benign
Transcript: ENSMUST00000151702
SMART Domains Protein: ENSMUSP00000115919
Gene: ENSMUSG00000008682

DomainStartEndE-ValueType
Pfam:Ribosomal_L16 5 167 1.5e-34 PFAM
Meta Mutation Damage Score 0.9711 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.9%
  • 10x: 97.9%
  • 20x: 96.6%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a deoxyribonuclease protein that shows high sequence similarity to DNase I. The encoded protein is localized to the endoplasmic reticulum and modified by N-linked glycosylation. Alternate transcriptional splice variants encoding the same protein have been observed. [provided by RefSeq, Jan 2015]
PHENOTYPE: Female mice homozygous for an inactivating mutation of this gene exhibit poor motor coordination on the rotarod even on days 4 and 5 of a 5-day test. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apobr A C 7: 126,187,196 (GRCm39) D89A probably damaging Het
Bhlhe41 C T 6: 145,808,694 (GRCm39) probably benign Het
Cacna1s G A 1: 136,023,523 (GRCm39) V674M probably benign Het
Cavin2 T C 1: 51,329,029 (GRCm39) probably null Het
Cd300lb T C 11: 114,815,763 (GRCm39) S106G possibly damaging Het
Ceacam15 A G 7: 16,407,121 (GRCm39) V132A probably benign Het
Ddi2 G T 4: 141,412,076 (GRCm39) Q279K probably benign Het
Dnah11 A G 12: 117,847,151 (GRCm39) V4304A probably damaging Het
Dnah2 C T 11: 69,349,746 (GRCm39) R2399Q probably benign Het
Epsti1 T A 14: 78,142,090 (GRCm39) H55Q probably benign Het
Flad1 T C 3: 89,318,503 (GRCm39) T17A probably damaging Het
Fzd2 C T 11: 102,496,981 (GRCm39) T475M probably damaging Het
Gemin5 C A 11: 58,020,887 (GRCm39) W1099L probably damaging Het
Gm9892 T C 8: 52,649,964 (GRCm39) noncoding transcript Het
Gmeb2 A G 2: 180,897,779 (GRCm39) probably benign Het
Grip1 A G 10: 119,765,833 (GRCm39) E55G probably damaging Het
Gvin-ps3 A T 7: 105,681,055 (GRCm39) noncoding transcript Het
Hltf T C 3: 20,162,276 (GRCm39) S825P probably damaging Het
Kcnh3 A T 15: 99,139,820 (GRCm39) Q902L probably null Het
Kcnt2 C T 1: 140,537,353 (GRCm39) P1037L probably damaging Het
Klhl18 G C 9: 110,265,195 (GRCm39) N335K possibly damaging Het
Lama5 A C 2: 179,835,594 (GRCm39) L1253R probably damaging Het
Lancl2 T G 6: 57,701,567 (GRCm39) S230A probably benign Het
Lmcd1 A G 6: 112,292,549 (GRCm39) M134V probably damaging Het
Lrrc23 C A 6: 124,751,445 (GRCm39) A205S probably damaging Het
Mfsd13b T A 7: 120,590,961 (GRCm39) I234N probably damaging Het
Mroh3 A G 1: 136,124,061 (GRCm39) S386P probably damaging Het
Mylk3 A C 8: 86,082,060 (GRCm39) F313V possibly damaging Het
Myo9b A T 8: 71,786,032 (GRCm39) Q643L possibly damaging Het
Nacad T C 11: 6,555,745 (GRCm39) S2G unknown Het
Olfr908 T C 9: 38,427,412 (GRCm39) F28S probably damaging Het
Or10z1 G T 1: 174,078,322 (GRCm39) T57K possibly damaging Het
Or2n1d C T 17: 38,646,347 (GRCm39) Q100* probably null Het
Or4x6 A T 2: 89,949,043 (GRCm39) W300R probably damaging Het
Pkd1 T C 17: 24,795,048 (GRCm39) V2245A probably damaging Het
Pkdrej G A 15: 85,701,319 (GRCm39) T1539I possibly damaging Het
Plch2 G T 4: 155,074,456 (GRCm39) probably null Het
Pygm G A 19: 6,434,609 (GRCm39) R34H probably damaging Het
Rgs12 T C 5: 35,178,448 (GRCm39) probably benign Het
Ruvbl1 T C 6: 88,462,890 (GRCm39) I338T probably damaging Het
Sapcd1 T A 17: 35,245,707 (GRCm39) Q104L probably damaging Het
Satb2 T C 1: 56,836,066 (GRCm39) E575G probably damaging Het
Sema6b T A 17: 56,434,091 (GRCm39) probably null Het
Slc25a11 T C 11: 70,537,011 (GRCm39) N15D probably damaging Het
Slc26a6 C T 9: 108,737,845 (GRCm39) T526M probably damaging Het
Tcaf3 G T 6: 42,564,444 (GRCm39) T906K possibly damaging Het
Thbd A T 2: 148,248,903 (GRCm39) C322S probably damaging Het
Traf2 A G 2: 25,410,452 (GRCm39) L399P probably damaging Het
Troap T A 15: 98,976,698 (GRCm39) V274D probably damaging Het
Utrn G A 10: 12,277,099 (GRCm39) T3406M probably damaging Het
Uts2 G T 4: 151,083,508 (GRCm39) A40S possibly damaging Het
Vmn2r109 T A 17: 20,774,603 (GRCm39) I251F possibly damaging Het
Vmn2r67 A G 7: 84,786,230 (GRCm39) S592P probably damaging Het
Vps13b T G 15: 35,876,559 (GRCm39) W2797G probably damaging Het
Ythdf1 A T 2: 180,553,981 (GRCm39) M51K probably damaging Het
Zfp60 T A 7: 27,437,955 (GRCm39) probably benign Het
Zfp882 T A 8: 72,668,204 (GRCm39) F344I probably damaging Het
Other mutations in Dnase1l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R4691:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R4752:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R4753:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R4814:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R4815:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R4846:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R4861:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R4862:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R4872:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R4873:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R4875:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R4978:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R4979:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R4980:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R4981:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R4982:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R4983:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R5039:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R5084:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R5085:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R5086:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R5087:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R5106:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R5107:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R5108:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R5109:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R5137:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R5171:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R5266:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R5330:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R5417:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R5418:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R5419:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R5448:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R5450:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R5466:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R5467:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R6126:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R6128:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R6129:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R6130:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R6232:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R6233:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R6234:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R6242:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R6305:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R6306:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R6329:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R6343:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R6344:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R6396:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R6397:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R6449:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R6450:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R6585:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R6586:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R6646:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R6679:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R6681:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R6845:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R6847:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R8526:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ATTGGTACCAGAGTGGCTGC -3'
(R):5'- AACCTGGATTCCTTTGGAGGG -3'

Sequencing Primer
(F):5'- CAACATCATTCCATTATACCTTACCC -3'
(R):5'- GGTTCCTGATGCACACATAGCAATG -3'
Posted On 2016-07-22