Incidental Mutation 'R5297:Olfr1111'
ID 405453
Institutional Source Beutler Lab
Gene Symbol Olfr1111
Ensembl Gene ENSMUSG00000075158
Gene Name olfactory receptor 1111
Synonyms MOR181-2, GA_x6K02T2Q125-48635468-48634530
MMRRC Submission 042880-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.171) question?
Stock # R5297 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 87149181-87152624 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 87150449 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 71 (I71V)
Ref Sequence ENSEMBL: ENSMUSP00000150760 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099860] [ENSMUST00000214492] [ENSMUST00000216378]
AlphaFold Q7TR55
Predicted Effect probably benign
Transcript: ENSMUST00000099860
AA Change: I71V

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000097446
Gene: ENSMUSG00000075158
AA Change: I71V

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 2.2e-54 PFAM
Pfam:7tm_1 41 290 7e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214492
AA Change: I71V

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
Predicted Effect probably benign
Transcript: ENSMUST00000216378
AA Change: I71V

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acbd6 G T 1: 155,587,458 A135S probably benign Het
Agbl4 A G 4: 111,566,698 K307R possibly damaging Het
AI481877 A G 4: 59,047,543 W1359R probably benign Het
Akna T C 4: 63,381,846 E653G possibly damaging Het
Arhgap26 T C 18: 39,121,888 Y273H probably damaging Het
Atg14 G A 14: 47,568,199 R70C probably damaging Het
Atp1a1 C T 3: 101,591,127 V250M possibly damaging Het
Cacna1c T G 6: 118,742,361 D215A probably damaging Het
Cadps T A 14: 12,822,345 N132Y probably damaging Het
Casp6 T C 3: 129,910,555 F97L possibly damaging Het
Ckap2l T C 2: 129,285,370 N296S possibly damaging Het
Col6a4 T C 9: 106,074,867 K611E probably benign Het
Copa A G 1: 172,113,108 H696R probably damaging Het
Cyp2a4 T A 7: 26,312,204 N283K probably benign Het
Dcc C T 18: 71,378,738 V869I probably benign Het
Efemp1 G T 11: 28,867,868 G116C probably damaging Het
F830045P16Rik T C 2: 129,460,553 E373G probably benign Het
Fbxo9 T C 9: 78,086,279 T318A probably benign Het
Gipr A G 7: 19,157,544 W403R probably damaging Het
Gm10093 A G 17: 78,492,758 S393G probably benign Het
Gm12794 T A 4: 101,941,151 D106E possibly damaging Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Golgb1 G A 16: 36,875,616 probably benign Het
Herc3 T C 6: 58,856,641 L171P probably damaging Het
Il5ra A G 6: 106,738,134 I221T probably benign Het
Itgb2 A G 10: 77,564,667 I705V probably damaging Het
Map4k4 G T 1: 39,962,217 V55F probably damaging Het
Mast1 A G 8: 84,913,318 probably null Het
Mitf G T 6: 97,994,430 G186V probably benign Het
Mtpn C T 6: 35,512,290 D100N probably benign Het
Nrcam T C 12: 44,544,784 F204L probably damaging Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr1510 A G 14: 52,410,218 L218P probably damaging Het
Olfr248 A G 1: 174,391,200 M44V probably benign Het
Olfr381 A T 11: 73,486,389 V145E probably damaging Het
Olfr446 T C 6: 42,927,437 S69P probably benign Het
Olfr503 A T 7: 108,545,404 N291I probably damaging Het
Pclo A T 5: 14,676,249 probably benign Het
Pik3ca T A 3: 32,450,053 Y631N probably damaging Het
Ptk2b T C 14: 66,172,517 D462G probably benign Het
Rnf19a A G 15: 36,247,778 S427P probably damaging Het
Scn3a T A 2: 65,469,034 Y1376F possibly damaging Het
Spem1 A G 11: 69,820,927 Y304H probably damaging Het
Stk38l C A 6: 146,775,655 Y450* probably null Het
Stx19 A G 16: 62,821,974 E51G probably damaging Het
Ttc41 C G 10: 86,776,579 Q1239E probably benign Het
Tuba3a C T 6: 125,281,340 R229H probably damaging Het
Utp18 A T 11: 93,876,089 V264D probably damaging Het
V1rd19 T C 7: 24,003,289 V60A probably damaging Het
Virma T G 4: 11,494,819 V40G probably damaging Het
Vmn1r160 C T 7: 22,871,290 Q23* probably null Het
Vmn2r13 T C 5: 109,191,939 I57V probably benign Het
Vmn2r26 T A 6: 124,061,873 F802L probably damaging Het
Vmn2r61 A G 7: 42,260,222 D57G probably benign Het
Vps13c A G 9: 67,878,131 N260S probably damaging Het
Xirp1 C A 9: 120,019,602 A72S probably damaging Het
Zfp212 T C 6: 47,929,077 V190A probably benign Het
Zfp703 C T 8: 26,979,205 P299L probably damaging Het
Other mutations in Olfr1111
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01023:Olfr1111 APN 2 87149825 missense possibly damaging 0.53
IGL02217:Olfr1111 APN 2 87149887 missense probably benign 0.00
R0789:Olfr1111 UTSW 2 87149827 missense probably damaging 1.00
R1437:Olfr1111 UTSW 2 87149771 missense possibly damaging 0.94
R1696:Olfr1111 UTSW 2 87150380 missense probably benign 0.00
R1700:Olfr1111 UTSW 2 87149779 missense probably damaging 1.00
R1717:Olfr1111 UTSW 2 87149806 nonsense probably null
R4965:Olfr1111 UTSW 2 87150659 start codon destroyed possibly damaging 0.89
R5221:Olfr1111 UTSW 2 87150481 missense probably damaging 1.00
R5837:Olfr1111 UTSW 2 87150355 missense probably benign 0.02
R6544:Olfr1111 UTSW 2 87149863 missense probably damaging 1.00
R6911:Olfr1111 UTSW 2 87149767 missense probably damaging 1.00
R8537:Olfr1111 UTSW 2 87150038 missense probably benign 0.02
R8969:Olfr1111 UTSW 2 87150584 missense probably benign
R9747:Olfr1111 UTSW 2 87150554 missense probably benign 0.21
Predicted Primers PCR Primer
(F):5'- CAGTGGGTTGCAAATGGCTG -3'
(R):5'- TGGATATCATCAACTGCCAATGAG -3'

Sequencing Primer
(F):5'- TGCATAGCGGTCGTATGCC -3'
(R):5'- AGCCCAAGAAGATGCAGTATAC -3'
Posted On 2016-07-22