Incidental Mutation 'R5297:F830045P16Rik'
ID405455
Institutional Source Beutler Lab
Gene Symbol F830045P16Rik
Ensembl Gene ENSMUSG00000043727
Gene NameRIKEN cDNA F830045P16 gene
SynonymsSirpb3
MMRRC Submission 042880-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R5297 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location129458359-129536602 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 129460553 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 373 (E373G)
Ref Sequence ENSEMBL: ENSMUSP00000058047 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050309]
Predicted Effect probably benign
Transcript: ENSMUST00000050309
AA Change: E373G

PolyPhen 2 Score 0.098 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000058047
Gene: ENSMUSG00000043727
AA Change: E373G

DomainStartEndE-ValueType
IG_like 51 123 7.95e-2 SMART
IGc1 156 227 5.66e-4 SMART
Pfam:C2-set_2 264 331 1.6e-6 PFAM
IGc1 359 432 2.28e-7 SMART
transmembrane domain 460 482 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acbd6 G T 1: 155,587,458 A135S probably benign Het
Agbl4 A G 4: 111,566,698 K307R possibly damaging Het
AI481877 A G 4: 59,047,543 W1359R probably benign Het
Akna T C 4: 63,381,846 E653G possibly damaging Het
Arhgap26 T C 18: 39,121,888 Y273H probably damaging Het
Atg14 G A 14: 47,568,199 R70C probably damaging Het
Atp1a1 C T 3: 101,591,127 V250M possibly damaging Het
Cacna1c T G 6: 118,742,361 D215A probably damaging Het
Cadps T A 14: 12,822,345 N132Y probably damaging Het
Casp6 T C 3: 129,910,555 F97L possibly damaging Het
Ckap2l T C 2: 129,285,370 N296S possibly damaging Het
Col6a4 T C 9: 106,074,867 K611E probably benign Het
Copa A G 1: 172,113,108 H696R probably damaging Het
Cyp2a4 T A 7: 26,312,204 N283K probably benign Het
Dcc C T 18: 71,378,738 V869I probably benign Het
Efemp1 G T 11: 28,867,868 G116C probably damaging Het
Fbxo9 T C 9: 78,086,279 T318A probably benign Het
Gipr A G 7: 19,157,544 W403R probably damaging Het
Gm10093 A G 17: 78,492,758 S393G probably benign Het
Gm12794 T A 4: 101,941,151 D106E possibly damaging Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Golgb1 G A 16: 36,875,616 probably benign Het
Herc3 T C 6: 58,856,641 L171P probably damaging Het
Il5ra A G 6: 106,738,134 I221T probably benign Het
Itgb2 A G 10: 77,564,667 I705V probably damaging Het
Map4k4 G T 1: 39,962,217 V55F probably damaging Het
Mast1 A G 8: 84,913,318 probably null Het
Mitf G T 6: 97,994,430 G186V probably benign Het
Mtpn C T 6: 35,512,290 D100N probably benign Het
Nrcam T C 12: 44,544,784 F204L probably damaging Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr1111 T C 2: 87,150,449 I71V probably benign Het
Olfr1510 A G 14: 52,410,218 L218P probably damaging Het
Olfr248 A G 1: 174,391,200 M44V probably benign Het
Olfr381 A T 11: 73,486,389 V145E probably damaging Het
Olfr446 T C 6: 42,927,437 S69P probably benign Het
Olfr503 A T 7: 108,545,404 N291I probably damaging Het
Pclo A T 5: 14,676,249 probably benign Het
Pik3ca T A 3: 32,450,053 Y631N probably damaging Het
Ptk2b T C 14: 66,172,517 D462G probably benign Het
Rnf19a A G 15: 36,247,778 S427P probably damaging Het
Scn3a T A 2: 65,469,034 Y1376F possibly damaging Het
Spem1 A G 11: 69,820,927 Y304H probably damaging Het
Stk38l C A 6: 146,775,655 Y450* probably null Het
Stx19 A G 16: 62,821,974 E51G probably damaging Het
Ttc41 C G 10: 86,776,579 Q1239E probably benign Het
Tuba3a C T 6: 125,281,340 R229H probably damaging Het
Utp18 A T 11: 93,876,089 V264D probably damaging Het
V1rd19 T C 7: 24,003,289 V60A probably damaging Het
Virma T G 4: 11,494,819 V40G probably damaging Het
Vmn1r160 C T 7: 22,871,290 Q23* probably null Het
Vmn2r13 T C 5: 109,191,939 I57V probably benign Het
Vmn2r26 T A 6: 124,061,873 F802L probably damaging Het
Vmn2r61 A G 7: 42,260,222 D57G probably benign Het
Vps13c A G 9: 67,878,131 N260S probably damaging Het
Xirp1 C A 9: 120,019,602 A72S probably damaging Het
Zfp212 T C 6: 47,929,077 V190A probably benign Het
Zfp703 C T 8: 26,979,205 P299L probably damaging Het
Other mutations in F830045P16Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:F830045P16Rik APN 2 129460529 missense probably damaging 0.97
IGL01149:F830045P16Rik APN 2 129460312 critical splice donor site probably null
IGL01556:F830045P16Rik APN 2 129463720 missense probably benign 0.01
IGL01690:F830045P16Rik APN 2 129472694 missense probably damaging 1.00
IGL02169:F830045P16Rik APN 2 129463572 missense probably damaging 1.00
IGL03194:F830045P16Rik APN 2 129460320 missense possibly damaging 0.91
IGL03231:F830045P16Rik APN 2 129460473 missense probably damaging 1.00
R0062:F830045P16Rik UTSW 2 129463704 missense possibly damaging 0.94
R0062:F830045P16Rik UTSW 2 129463704 missense possibly damaging 0.94
R0234:F830045P16Rik UTSW 2 129463464 missense possibly damaging 0.85
R0234:F830045P16Rik UTSW 2 129463464 missense possibly damaging 0.85
R0333:F830045P16Rik UTSW 2 129472857 missense probably damaging 0.96
R0479:F830045P16Rik UTSW 2 129472688 missense possibly damaging 0.86
R0550:F830045P16Rik UTSW 2 129463509 missense probably damaging 1.00
R0827:F830045P16Rik UTSW 2 129472776 missense probably benign 0.01
R1087:F830045P16Rik UTSW 2 129472719 missense possibly damaging 0.55
R1142:F830045P16Rik UTSW 2 129460332 nonsense probably null
R1642:F830045P16Rik UTSW 2 129463714 missense probably benign 0.00
R2022:F830045P16Rik UTSW 2 129472665 missense probably damaging 1.00
R2044:F830045P16Rik UTSW 2 129459397 missense possibly damaging 0.68
R4008:F830045P16Rik UTSW 2 129463547 missense probably damaging 1.00
R4009:F830045P16Rik UTSW 2 129463547 missense probably damaging 1.00
R4011:F830045P16Rik UTSW 2 129463547 missense probably damaging 1.00
R4212:F830045P16Rik UTSW 2 129460353 missense probably benign 0.00
R4579:F830045P16Rik UTSW 2 129463503 missense probably damaging 0.97
R4838:F830045P16Rik UTSW 2 129460550 missense possibly damaging 0.95
R5190:F830045P16Rik UTSW 2 129472715 missense probably benign 0.01
R5217:F830045P16Rik UTSW 2 129463573 missense probably damaging 1.00
R5352:F830045P16Rik UTSW 2 129472901 missense probably damaging 0.98
R6063:F830045P16Rik UTSW 2 129474390 missense probably damaging 1.00
R6072:F830045P16Rik UTSW 2 129472694 missense probably damaging 1.00
R6173:F830045P16Rik UTSW 2 129463668 missense probably damaging 1.00
R6383:F830045P16Rik UTSW 2 129536438 missense probably benign 0.04
R6386:F830045P16Rik UTSW 2 129472818 missense probably damaging 1.00
R6425:F830045P16Rik UTSW 2 129460580 missense probably damaging 1.00
R6699:F830045P16Rik UTSW 2 129460421 missense probably damaging 0.98
R6869:F830045P16Rik UTSW 2 129474561 missense probably damaging 0.99
R7751:F830045P16Rik UTSW 2 129460447 missense probably damaging 1.00
R8012:F830045P16Rik UTSW 2 129474432 missense possibly damaging 0.92
R8097:F830045P16Rik UTSW 2 129463585 missense possibly damaging 0.55
Z1176:F830045P16Rik UTSW 2 129536530 start gained probably benign
Predicted Primers PCR Primer
(F):5'- GCAGACAATACAATGCTGGC -3'
(R):5'- AATCCTTATTTGTGGCAGGCAC -3'

Sequencing Primer
(F):5'- CAATACAATGCTGGCCTGGATG -3'
(R):5'- CACTGGGTTGGGCCTTGAAG -3'
Posted On2016-07-22