Incidental Mutation 'R5297:Pik3ca'
ID405456
Institutional Source Beutler Lab
Gene Symbol Pik3ca
Ensembl Gene ENSMUSG00000027665
Gene Namephosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit alpha
SynonymscaPI3K, 6330412C24Rik, p110alpha
MMRRC Submission 042880-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5297 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location32397671-32468486 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 32450053 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 631 (Y631N)
Ref Sequence ENSEMBL: ENSMUSP00000103878 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029201] [ENSMUST00000108242] [ENSMUST00000108243]
Predicted Effect probably damaging
Transcript: ENSMUST00000029201
AA Change: Y631N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000029201
Gene: ENSMUSG00000027665
AA Change: Y631N

DomainStartEndE-ValueType
PI3K_p85B 31 108 3.03e-46 SMART
PI3K_rbd 173 292 5e-47 SMART
PI3K_C2 322 425 2.39e-35 SMART
C2 333 441 3.95e-1 SMART
PI3Ka 518 704 8.35e-99 SMART
Blast:PI3Kc 733 766 1e-11 BLAST
PI3Kc 798 1065 8.82e-130 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000108242
AA Change: Y509N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000103877
Gene: ENSMUSG00000027665
AA Change: Y509N

DomainStartEndE-ValueType
PI3K_rbd 51 170 5e-47 SMART
PI3K_C2 200 303 2.39e-35 SMART
C2 211 319 3.95e-1 SMART
PI3Ka 396 582 8.35e-99 SMART
Blast:PI3Kc 611 644 1e-11 BLAST
PI3Kc 676 943 8.82e-130 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000108243
AA Change: Y631N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000103878
Gene: ENSMUSG00000027665
AA Change: Y631N

DomainStartEndE-ValueType
PI3K_p85B 31 108 3.03e-46 SMART
PI3K_rbd 173 292 5e-47 SMART
PI3K_C2 322 425 2.39e-35 SMART
C2 333 441 3.95e-1 SMART
PI3Ka 518 704 8.35e-99 SMART
Blast:PI3Kc 733 766 1e-11 BLAST
PI3Kc 798 1065 8.82e-130 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192994
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphatidylinositol 3-kinase is composed of an 85 kDa regulatory subunit and a 110 kDa catalytic subunit. The protein encoded by this gene represents the catalytic subunit, which uses ATP to phosphorylate PtdIns, PtdIns4P and PtdIns(4,5)P2. This gene has been found to be oncogenic and has been implicated in cervical cancers. A pseudogene of this gene has been defined on chromosome 22. [provided by RefSeq, Apr 2016]
PHENOTYPE: Homozygous null or knock-in mutations of this gene lead to embryonic death associated with growth retardation, vascular defects and hemorrhage. Surviving mice homozygous for a knock-in allele show impaired lymphangiogenesis, ascites, reduced weight, and resistance to Ras-driven skin tumorigenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acbd6 G T 1: 155,587,458 A135S probably benign Het
Agbl4 A G 4: 111,566,698 K307R possibly damaging Het
AI481877 A G 4: 59,047,543 W1359R probably benign Het
Akna T C 4: 63,381,846 E653G possibly damaging Het
Arhgap26 T C 18: 39,121,888 Y273H probably damaging Het
Atg14 G A 14: 47,568,199 R70C probably damaging Het
Atp1a1 C T 3: 101,591,127 V250M possibly damaging Het
Cacna1c T G 6: 118,742,361 D215A probably damaging Het
Cadps T A 14: 12,822,345 N132Y probably damaging Het
Casp6 T C 3: 129,910,555 F97L possibly damaging Het
Ckap2l T C 2: 129,285,370 N296S possibly damaging Het
Col6a4 T C 9: 106,074,867 K611E probably benign Het
Copa A G 1: 172,113,108 H696R probably damaging Het
Cyp2a4 T A 7: 26,312,204 N283K probably benign Het
Dcc C T 18: 71,378,738 V869I probably benign Het
Efemp1 G T 11: 28,867,868 G116C probably damaging Het
F830045P16Rik T C 2: 129,460,553 E373G probably benign Het
Fbxo9 T C 9: 78,086,279 T318A probably benign Het
Gipr A G 7: 19,157,544 W403R probably damaging Het
Gm10093 A G 17: 78,492,758 S393G probably benign Het
Gm12794 T A 4: 101,941,151 D106E possibly damaging Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Golgb1 G A 16: 36,875,616 probably benign Het
Herc3 T C 6: 58,856,641 L171P probably damaging Het
Il5ra A G 6: 106,738,134 I221T probably benign Het
Itgb2 A G 10: 77,564,667 I705V probably damaging Het
Map4k4 G T 1: 39,962,217 V55F probably damaging Het
Mast1 A G 8: 84,913,318 probably null Het
Mitf G T 6: 97,994,430 G186V probably benign Het
Mtpn C T 6: 35,512,290 D100N probably benign Het
Nrcam T C 12: 44,544,784 F204L probably damaging Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr1111 T C 2: 87,150,449 I71V probably benign Het
Olfr1510 A G 14: 52,410,218 L218P probably damaging Het
Olfr248 A G 1: 174,391,200 M44V probably benign Het
Olfr381 A T 11: 73,486,389 V145E probably damaging Het
Olfr446 T C 6: 42,927,437 S69P probably benign Het
Olfr503 A T 7: 108,545,404 N291I probably damaging Het
Pclo A T 5: 14,676,249 probably benign Het
Ptk2b T C 14: 66,172,517 D462G probably benign Het
Rnf19a A G 15: 36,247,778 S427P probably damaging Het
Scn3a T A 2: 65,469,034 Y1376F possibly damaging Het
Spem1 A G 11: 69,820,927 Y304H probably damaging Het
Stk38l C A 6: 146,775,655 Y450* probably null Het
Stx19 A G 16: 62,821,974 E51G probably damaging Het
Ttc41 C G 10: 86,776,579 Q1239E probably benign Het
Tuba3a C T 6: 125,281,340 R229H probably damaging Het
Utp18 A T 11: 93,876,089 V264D probably damaging Het
V1rd19 T C 7: 24,003,289 V60A probably damaging Het
Virma T G 4: 11,494,819 V40G probably damaging Het
Vmn1r160 C T 7: 22,871,290 Q23* probably null Het
Vmn2r13 T C 5: 109,191,939 I57V probably benign Het
Vmn2r26 T A 6: 124,061,873 F802L probably damaging Het
Vmn2r61 A G 7: 42,260,222 D57G probably benign Het
Vps13c A G 9: 67,878,131 N260S probably damaging Het
Xirp1 C A 9: 120,019,602 A72S probably damaging Het
Zfp212 T C 6: 47,929,077 V190A probably benign Het
Zfp703 C T 8: 26,979,205 P299L probably damaging Het
Other mutations in Pik3ca
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01284:Pik3ca APN 3 32462584 missense probably damaging 1.00
IGL01894:Pik3ca APN 3 32450026 missense possibly damaging 0.91
IGL03118:Pik3ca APN 3 32459935 missense probably damaging 1.00
IGL03184:Pik3ca APN 3 32439886 missense probably benign 0.27
IGL03401:Pik3ca APN 3 32437814 splice site probably null
Peninsular UTSW 3 32462821 missense probably benign 0.38
R0084:Pik3ca UTSW 3 32462788 missense possibly damaging 0.78
R0116:Pik3ca UTSW 3 32459945 missense probably damaging 1.00
R0278:Pik3ca UTSW 3 32439753 missense possibly damaging 0.60
R0513:Pik3ca UTSW 3 32461511 missense probably damaging 1.00
R0543:Pik3ca UTSW 3 32450261 critical splice acceptor site probably null
R0622:Pik3ca UTSW 3 32436552 missense probably damaging 1.00
R0630:Pik3ca UTSW 3 32450027 missense possibly damaging 0.91
R1193:Pik3ca UTSW 3 32456093 missense probably damaging 0.99
R1292:Pik3ca UTSW 3 32454420 missense probably damaging 1.00
R1464:Pik3ca UTSW 3 32461841 missense probably damaging 1.00
R1464:Pik3ca UTSW 3 32461841 missense probably damaging 1.00
R1869:Pik3ca UTSW 3 32450350 missense probably damaging 0.99
R1962:Pik3ca UTSW 3 32443867 missense probably benign 0.27
R1969:Pik3ca UTSW 3 32451754 critical splice acceptor site probably null
R2006:Pik3ca UTSW 3 32450057 missense probably damaging 1.00
R2264:Pik3ca UTSW 3 32437927 missense possibly damaging 0.65
R2366:Pik3ca UTSW 3 32462794 nonsense probably null
R2680:Pik3ca UTSW 3 32436548 nonsense probably null
R2680:Pik3ca UTSW 3 32443885 missense probably benign 0.00
R3001:Pik3ca UTSW 3 32462797 missense probably damaging 1.00
R3002:Pik3ca UTSW 3 32462797 missense probably damaging 1.00
R4303:Pik3ca UTSW 3 32439935 nonsense probably null
R4416:Pik3ca UTSW 3 32461530 missense probably damaging 0.99
R4758:Pik3ca UTSW 3 32437978 missense probably benign 0.20
R4822:Pik3ca UTSW 3 32437982 missense probably benign 0.04
R4856:Pik3ca UTSW 3 32437163 missense probably damaging 1.00
R4886:Pik3ca UTSW 3 32437163 missense probably damaging 1.00
R5636:Pik3ca UTSW 3 32461560 missense probably damaging 1.00
R5663:Pik3ca UTSW 3 32462779 missense probably damaging 1.00
R6249:Pik3ca UTSW 3 32461563 missense probably damaging 1.00
R6264:Pik3ca UTSW 3 32440714 critical splice donor site probably null
R6347:Pik3ca UTSW 3 32462821 missense probably benign 0.38
R6538:Pik3ca UTSW 3 32439704 missense probably damaging 1.00
R7020:Pik3ca UTSW 3 32436279 missense probably damaging 0.97
R7720:Pik3ca UTSW 3 32436218 missense probably damaging 1.00
R7864:Pik3ca UTSW 3 32443613 nonsense probably null
R7947:Pik3ca UTSW 3 32443613 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCTTGTGCAGTACCCATGGG -3'
(R):5'- AGGTCCATTTCTCTATGGCTG -3'

Sequencing Primer
(F):5'- CAGAAAATCCGCATCAATTTAGAGG -3'
(R):5'- CCATTTCTCTATGGCTGAACTTAAAG -3'
Posted On2016-07-22