Mutagenetix > Incidental Mutation

Incidental Mutation 'R5297:Pik3ca'

405456

Institutional Source

Beutler Lab

Gene Symbol

Pik3ca

Ensembl Gene

ENSMUSG00000027665

Gene Name

phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit alpha

Synonyms

caPI3K, 6330412C24Rik, p110alpha

MMRRC Submission

042880-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5297 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

32397671-32468486 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 32450053 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Asparagine at position 631 (Y631N)

Ref Sequence

ENSEMBL: ENSMUSP00000103878 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029201] [ENSMUST00000108242] [ENSMUST00000108243]

AlphaFold

P42337

Predicted Effect

probably damaging
Transcript: ENSMUST00000029201
AA Change: Y631N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000029201
Gene: ENSMUSG00000027665
AA Change: Y631N

Domain	Start	End	E-Value	Type
PI3K_p85B	31	108	3.03e-46	SMART
PI3K_rbd	173	292	5e-47	SMART
PI3K_C2	322	425	2.39e-35	SMART
C2	333	441	3.95e-1	SMART
PI3Ka	518	704	8.35e-99	SMART
Blast:PI3Kc	733	766	1e-11	BLAST
PI3Kc	798	1065	8.82e-130	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000108242
AA Change: Y509N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000103877
Gene: ENSMUSG00000027665
AA Change: Y509N

Domain	Start	End	E-Value	Type
PI3K_rbd	51	170	5e-47	SMART
PI3K_C2	200	303	2.39e-35	SMART
C2	211	319	3.95e-1	SMART
PI3Ka	396	582	8.35e-99	SMART
Blast:PI3Kc	611	644	1e-11	BLAST
PI3Kc	676	943	8.82e-130	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000108243
AA Change: Y631N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000103878
Gene: ENSMUSG00000027665
AA Change: Y631N

Domain	Start	End	E-Value	Type
PI3K_p85B	31	108	3.03e-46	SMART
PI3K_rbd	173	292	5e-47	SMART
PI3K_C2	322	425	2.39e-35	SMART
C2	333	441	3.95e-1	SMART
PI3Ka	518	704	8.35e-99	SMART
Blast:PI3Kc	733	766	1e-11	BLAST
PI3Kc	798	1065	8.82e-130	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000192994

Coding Region Coverage

1x: 99.4%
3x: 98.7%
10x: 97.4%
20x: 95.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphatidylinositol 3-kinase is composed of an 85 kDa regulatory subunit and a 110 kDa catalytic subunit. The protein encoded by this gene represents the catalytic subunit, which uses ATP to phosphorylate PtdIns, PtdIns4P and PtdIns(4,5)P2. This gene has been found to be oncogenic and has been implicated in cervical cancers. A pseudogene of this gene has been defined on chromosome 22. [provided by RefSeq, Apr 2016]
PHENOTYPE: Homozygous null or knock-in mutations of this gene lead to embryonic death associated with growth retardation, vascular defects and hemorrhage. Surviving mice homozygous for a knock-in allele show impaired lymphangiogenesis, ascites, reduced weight, and resistance to Ras-driven skin tumorigenesis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acbd6	G	T	1: 155,587,458	A135S	probably benign	Het
Agbl4	A	G	4: 111,566,698	K307R	possibly damaging	Het
AI481877	A	G	4: 59,047,543	W1359R	probably benign	Het
Akna	T	C	4: 63,381,846	E653G	possibly damaging	Het
Arhgap26	T	C	18: 39,121,888	Y273H	probably damaging	Het
Atg14	G	A	14: 47,568,199	R70C	probably damaging	Het
Atp1a1	C	T	3: 101,591,127	V250M	possibly damaging	Het
Cacna1c	T	G	6: 118,742,361	D215A	probably damaging	Het
Cadps	T	A	14: 12,822,345	N132Y	probably damaging	Het
Casp6	T	C	3: 129,910,555	F97L	possibly damaging	Het
Ckap2l	T	C	2: 129,285,370	N296S	possibly damaging	Het
Col6a4	T	C	9: 106,074,867	K611E	probably benign	Het
Copa	A	G	1: 172,113,108	H696R	probably damaging	Het
Cyp2a4	T	A	7: 26,312,204	N283K	probably benign	Het
Dcc	C	T	18: 71,378,738	V869I	probably benign	Het
Efemp1	G	T	11: 28,867,868	G116C	probably damaging	Het
F830045P16Rik	T	C	2: 129,460,553	E373G	probably benign	Het
Fbxo9	T	C	9: 78,086,279	T318A	probably benign	Het
Gipr	A	G	7: 19,157,544	W403R	probably damaging	Het
Gm10093	A	G	17: 78,492,758	S393G	probably benign	Het
Gm12794	T	A	4: 101,941,151	D106E	possibly damaging	Het
Gm4787	G	C	12: 81,377,830	T518S	probably benign	Het
Golgb1	G	A	16: 36,875,616		probably benign	Het
Herc3	T	C	6: 58,856,641	L171P	probably damaging	Het
Il5ra	A	G	6: 106,738,134	I221T	probably benign	Het
Itgb2	A	G	10: 77,564,667	I705V	probably damaging	Het
Map4k4	G	T	1: 39,962,217	V55F	probably damaging	Het
Mast1	A	G	8: 84,913,318		probably null	Het
Mitf	G	T	6: 97,994,430	G186V	probably benign	Het
Mtpn	C	T	6: 35,512,290	D100N	probably benign	Het
Nrcam	T	C	12: 44,544,784	F204L	probably damaging	Het
Olfr1	AGCGGTCGTAGGC	AGC	11: 73,395,654		probably null	Het
Olfr1111	T	C	2: 87,150,449	I71V	probably benign	Het
Olfr1510	A	G	14: 52,410,218	L218P	probably damaging	Het
Olfr248	A	G	1: 174,391,200	M44V	probably benign	Het
Olfr381	A	T	11: 73,486,389	V145E	probably damaging	Het
Olfr446	T	C	6: 42,927,437	S69P	probably benign	Het
Olfr503	A	T	7: 108,545,404	N291I	probably damaging	Het
Pclo	A	T	5: 14,676,249		probably benign	Het
Ptk2b	T	C	14: 66,172,517	D462G	probably benign	Het
Rnf19a	A	G	15: 36,247,778	S427P	probably damaging	Het
Scn3a	T	A	2: 65,469,034	Y1376F	possibly damaging	Het
Spem1	A	G	11: 69,820,927	Y304H	probably damaging	Het
Stk38l	C	A	6: 146,775,655	Y450*	probably null	Het
Stx19	A	G	16: 62,821,974	E51G	probably damaging	Het
Ttc41	C	G	10: 86,776,579	Q1239E	probably benign	Het
Tuba3a	C	T	6: 125,281,340	R229H	probably damaging	Het
Utp18	A	T	11: 93,876,089	V264D	probably damaging	Het
V1rd19	T	C	7: 24,003,289	V60A	probably damaging	Het
Virma	T	G	4: 11,494,819	V40G	probably damaging	Het
Vmn1r160	C	T	7: 22,871,290	Q23*	probably null	Het
Vmn2r13	T	C	5: 109,191,939	I57V	probably benign	Het
Vmn2r26	T	A	6: 124,061,873	F802L	probably damaging	Het
Vmn2r61	A	G	7: 42,260,222	D57G	probably benign	Het
Vps13c	A	G	9: 67,878,131	N260S	probably damaging	Het
Xirp1	C	A	9: 120,019,602	A72S	probably damaging	Het
Zfp212	T	C	6: 47,929,077	V190A	probably benign	Het
Zfp703	C	T	8: 26,979,205	P299L	probably damaging	Het

Other mutations in Pik3ca

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01284:Pik3ca	APN	3	32462584	missense	probably damaging	1.00
IGL01894:Pik3ca	APN	3	32450026	missense	possibly damaging	0.91
IGL03118:Pik3ca	APN	3	32459935	missense	probably damaging	1.00
IGL03184:Pik3ca	APN	3	32439886	missense	probably benign	0.27
IGL03401:Pik3ca	APN	3	32437814	splice site	probably null
Interrupted	UTSW	3	32438062	missense	probably damaging	1.00
Lilfella	UTSW	3	32454420	missense	probably damaging	1.00
Peninsular	UTSW	3	32462821	missense	probably benign	0.38
Severed	UTSW	3	32437927	missense	possibly damaging	0.65
R0084:Pik3ca	UTSW	3	32462788	missense	possibly damaging	0.78
R0116:Pik3ca	UTSW	3	32459945	missense	probably damaging	1.00
R0278:Pik3ca	UTSW	3	32439753	missense	possibly damaging	0.60
R0513:Pik3ca	UTSW	3	32461511	missense	probably damaging	1.00
R0543:Pik3ca	UTSW	3	32450261	critical splice acceptor site	probably null
R0622:Pik3ca	UTSW	3	32436552	missense	probably damaging	1.00
R0630:Pik3ca	UTSW	3	32450027	missense	possibly damaging	0.91
R1193:Pik3ca	UTSW	3	32456093	missense	probably damaging	0.99
R1292:Pik3ca	UTSW	3	32454420	missense	probably damaging	1.00
R1464:Pik3ca	UTSW	3	32461841	missense	probably damaging	1.00
R1464:Pik3ca	UTSW	3	32461841	missense	probably damaging	1.00
R1869:Pik3ca	UTSW	3	32450350	missense	probably damaging	0.99
R1962:Pik3ca	UTSW	3	32443867	missense	probably benign	0.27
R1969:Pik3ca	UTSW	3	32451754	critical splice acceptor site	probably null
R2006:Pik3ca	UTSW	3	32450057	missense	probably damaging	1.00
R2264:Pik3ca	UTSW	3	32437927	missense	possibly damaging	0.65
R2366:Pik3ca	UTSW	3	32462794	nonsense	probably null
R2680:Pik3ca	UTSW	3	32436548	nonsense	probably null
R2680:Pik3ca	UTSW	3	32443885	missense	probably benign	0.00
R3001:Pik3ca	UTSW	3	32462797	missense	probably damaging	1.00
R3002:Pik3ca	UTSW	3	32462797	missense	probably damaging	1.00
R4303:Pik3ca	UTSW	3	32439935	nonsense	probably null
R4416:Pik3ca	UTSW	3	32461530	missense	probably damaging	0.99
R4758:Pik3ca	UTSW	3	32437978	missense	probably benign	0.20
R4822:Pik3ca	UTSW	3	32437982	missense	probably benign	0.04
R4856:Pik3ca	UTSW	3	32437163	missense	probably damaging	1.00
R4886:Pik3ca	UTSW	3	32437163	missense	probably damaging	1.00
R5636:Pik3ca	UTSW	3	32461560	missense	probably damaging	1.00
R5663:Pik3ca	UTSW	3	32462779	missense	probably damaging	1.00
R6249:Pik3ca	UTSW	3	32461563	missense	probably damaging	1.00
R6264:Pik3ca	UTSW	3	32440714	critical splice donor site	probably null
R6347:Pik3ca	UTSW	3	32462821	missense	probably benign	0.38
R6538:Pik3ca	UTSW	3	32439704	missense	probably damaging	1.00
R7020:Pik3ca	UTSW	3	32436279	missense	probably damaging	0.97
R7720:Pik3ca	UTSW	3	32436218	missense	probably damaging	1.00
R7864:Pik3ca	UTSW	3	32443613	nonsense	probably null
R8218:Pik3ca	UTSW	3	32437847	missense	possibly damaging	0.74
R8478:Pik3ca	UTSW	3	32451848	missense	probably benign
R9100:Pik3ca	UTSW	3	32460019	missense	probably damaging	1.00
R9169:Pik3ca	UTSW	3	32449606	critical splice donor site	probably null
R9255:Pik3ca	UTSW	3	32442832	critical splice donor site	probably null
R9267:Pik3ca	UTSW	3	32438062	missense	probably damaging	1.00
R9278:Pik3ca	UTSW	3	32454438	missense	probably damaging	1.00
R9501:Pik3ca	UTSW	3	32449913	missense	probably damaging	1.00
R9555:Pik3ca	UTSW	3	32451767	missense	probably damaging	1.00
Z1177:Pik3ca	UTSW	3	32437967	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCTTGTGCAGTACCCATGGG -3'
(R):5'- AGGTCCATTTCTCTATGGCTG -3'

Sequencing Primer
(F):5'- CAGAAAATCCGCATCAATTTAGAGG -3'
(R):5'- CCATTTCTCTATGGCTGAACTTAAAG -3'

Posted On

2016-07-22