Incidental Mutation 'R5297:Agbl4'
ID 405464
Institutional Source Beutler Lab
Gene Symbol Agbl4
Ensembl Gene ENSMUSG00000061298
Gene Name ATP/GTP binding protein-like 4
Synonyms 4931433A01Rik, 4930578N11Rik
MMRRC Submission 042880-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R5297 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 110397661-111664324 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 111566698 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Arginine at position 307 (K307R)
Ref Sequence ENSEMBL: ENSMUSP00000102202 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080744] [ENSMUST00000097920] [ENSMUST00000106591] [ENSMUST00000106592]
AlphaFold Q09LZ8
Predicted Effect probably benign
Transcript: ENSMUST00000080744
AA Change: K307R

PolyPhen 2 Score 0.218 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000079568
Gene: ENSMUSG00000061298
AA Change: K307R

DomainStartEndE-ValueType
Zn_pept 169 436 4.95e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000097920
AA Change: K307R

PolyPhen 2 Score 0.218 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000095533
Gene: ENSMUSG00000061298
AA Change: K307R

DomainStartEndE-ValueType
Zn_pept 169 465 3.6e-4 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000106591
AA Change: K307R

PolyPhen 2 Score 0.585 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000102201
Gene: ENSMUSG00000061298
AA Change: K307R

DomainStartEndE-ValueType
Pfam:Peptidase_M14 174 321 3.7e-33 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000106592
AA Change: K307R

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000102202
Gene: ENSMUSG00000061298
AA Change: K307R

DomainStartEndE-ValueType
Zn_pept 169 436 4.95e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142460
Predicted Effect unknown
Transcript: ENSMUST00000148038
AA Change: K152R
SMART Domains Protein: ENSMUSP00000118551
Gene: ENSMUSG00000061298
AA Change: K152R

DomainStartEndE-ValueType
Zn_pept 15 267 9.65e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154123
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal platelet morphology and physiology, impaired megakaryopoiesis, increased spleen weight and increased susceptibility to HSV or VACV infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acbd6 G T 1: 155,587,458 A135S probably benign Het
AI481877 A G 4: 59,047,543 W1359R probably benign Het
Akna T C 4: 63,381,846 E653G possibly damaging Het
Arhgap26 T C 18: 39,121,888 Y273H probably damaging Het
Atg14 G A 14: 47,568,199 R70C probably damaging Het
Atp1a1 C T 3: 101,591,127 V250M possibly damaging Het
Cacna1c T G 6: 118,742,361 D215A probably damaging Het
Cadps T A 14: 12,822,345 N132Y probably damaging Het
Casp6 T C 3: 129,910,555 F97L possibly damaging Het
Ckap2l T C 2: 129,285,370 N296S possibly damaging Het
Col6a4 T C 9: 106,074,867 K611E probably benign Het
Copa A G 1: 172,113,108 H696R probably damaging Het
Cyp2a4 T A 7: 26,312,204 N283K probably benign Het
Dcc C T 18: 71,378,738 V869I probably benign Het
Efemp1 G T 11: 28,867,868 G116C probably damaging Het
F830045P16Rik T C 2: 129,460,553 E373G probably benign Het
Fbxo9 T C 9: 78,086,279 T318A probably benign Het
Gipr A G 7: 19,157,544 W403R probably damaging Het
Gm10093 A G 17: 78,492,758 S393G probably benign Het
Gm12794 T A 4: 101,941,151 D106E possibly damaging Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Golgb1 G A 16: 36,875,616 probably benign Het
Herc3 T C 6: 58,856,641 L171P probably damaging Het
Il5ra A G 6: 106,738,134 I221T probably benign Het
Itgb2 A G 10: 77,564,667 I705V probably damaging Het
Map4k4 G T 1: 39,962,217 V55F probably damaging Het
Mast1 A G 8: 84,913,318 probably null Het
Mitf G T 6: 97,994,430 G186V probably benign Het
Mtpn C T 6: 35,512,290 D100N probably benign Het
Nrcam T C 12: 44,544,784 F204L probably damaging Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr1111 T C 2: 87,150,449 I71V probably benign Het
Olfr1510 A G 14: 52,410,218 L218P probably damaging Het
Olfr248 A G 1: 174,391,200 M44V probably benign Het
Olfr381 A T 11: 73,486,389 V145E probably damaging Het
Olfr446 T C 6: 42,927,437 S69P probably benign Het
Olfr503 A T 7: 108,545,404 N291I probably damaging Het
Pclo A T 5: 14,676,249 probably benign Het
Pik3ca T A 3: 32,450,053 Y631N probably damaging Het
Ptk2b T C 14: 66,172,517 D462G probably benign Het
Rnf19a A G 15: 36,247,778 S427P probably damaging Het
Scn3a T A 2: 65,469,034 Y1376F possibly damaging Het
Spem1 A G 11: 69,820,927 Y304H probably damaging Het
Stk38l C A 6: 146,775,655 Y450* probably null Het
Stx19 A G 16: 62,821,974 E51G probably damaging Het
Ttc41 C G 10: 86,776,579 Q1239E probably benign Het
Tuba3a C T 6: 125,281,340 R229H probably damaging Het
Utp18 A T 11: 93,876,089 V264D probably damaging Het
V1rd19 T C 7: 24,003,289 V60A probably damaging Het
Virma T G 4: 11,494,819 V40G probably damaging Het
Vmn1r160 C T 7: 22,871,290 Q23* probably null Het
Vmn2r13 T C 5: 109,191,939 I57V probably benign Het
Vmn2r26 T A 6: 124,061,873 F802L probably damaging Het
Vmn2r61 A G 7: 42,260,222 D57G probably benign Het
Vps13c A G 9: 67,878,131 N260S probably damaging Het
Xirp1 C A 9: 120,019,602 A72S probably damaging Het
Zfp212 T C 6: 47,929,077 V190A probably benign Het
Zfp703 C T 8: 26,979,205 P299L probably damaging Het
Other mutations in Agbl4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00548:Agbl4 APN 4 111118884 missense probably damaging 1.00
IGL02961:Agbl4 APN 4 110580121 missense probably damaging 1.00
IGL03383:Agbl4 APN 4 111657423 intron probably benign
IGL03401:Agbl4 APN 4 111119019 missense probably damaging 0.99
I1329:Agbl4 UTSW 4 110478455 splice site probably benign
R0277:Agbl4 UTSW 4 111617222 missense probably damaging 1.00
R0323:Agbl4 UTSW 4 111617222 missense probably damaging 1.00
R0690:Agbl4 UTSW 4 111657388 missense probably benign 0.35
R1086:Agbl4 UTSW 4 110478594 splice site probably benign
R1099:Agbl4 UTSW 4 110955663 critical splice donor site probably null
R1172:Agbl4 UTSW 4 111656318 splice site probably benign
R1480:Agbl4 UTSW 4 111566717 missense possibly damaging 0.56
R1508:Agbl4 UTSW 4 111656398 missense probably benign 0.10
R1564:Agbl4 UTSW 4 110955564 splice site probably null
R1610:Agbl4 UTSW 4 111657168 missense probably benign 0.00
R1869:Agbl4 UTSW 4 111566629 missense possibly damaging 0.91
R1989:Agbl4 UTSW 4 111566682 missense possibly damaging 0.92
R2327:Agbl4 UTSW 4 111526601 missense probably benign 0.00
R4780:Agbl4 UTSW 4 111657331 missense possibly damaging 0.73
R4806:Agbl4 UTSW 4 110955637 missense probably damaging 1.00
R4814:Agbl4 UTSW 4 111656368 missense possibly damaging 0.60
R5077:Agbl4 UTSW 4 111566742 missense probably benign 0.00
R5079:Agbl4 UTSW 4 111566629 missense possibly damaging 0.91
R5091:Agbl4 UTSW 4 111119040 missense possibly damaging 0.79
R5124:Agbl4 UTSW 4 111656328 missense probably benign 0.21
R5645:Agbl4 UTSW 4 111657330 missense possibly damaging 0.53
R5996:Agbl4 UTSW 4 110955672 splice site probably null
R6363:Agbl4 UTSW 4 111566785 intron probably benign
R6492:Agbl4 UTSW 4 111547272 missense probably damaging 1.00
R6617:Agbl4 UTSW 4 110580135 missense probably damaging 1.00
R6709:Agbl4 UTSW 4 111566782 intron probably benign
R6873:Agbl4 UTSW 4 111566659 missense possibly damaging 0.76
R7015:Agbl4 UTSW 4 110478500 missense probably damaging 1.00
R7105:Agbl4 UTSW 4 111566723 missense probably benign 0.06
R7143:Agbl4 UTSW 4 111617136 missense probably damaging 1.00
R7413:Agbl4 UTSW 4 111657298 missense probably benign 0.23
R7489:Agbl4 UTSW 4 111526658 missense probably damaging 1.00
R7583:Agbl4 UTSW 4 111118953 missense possibly damaging 0.89
R7796:Agbl4 UTSW 4 110660968 missense unknown
R8023:Agbl4 UTSW 4 111617148 missense probably benign 0.05
R8058:Agbl4 UTSW 4 110660842 missense unknown
R8342:Agbl4 UTSW 4 111119027 missense probably damaging 1.00
R8366:Agbl4 UTSW 4 111566664 missense probably damaging 1.00
R8691:Agbl4 UTSW 4 111662959 missense probably benign 0.03
Z1176:Agbl4 UTSW 4 110660839 missense probably damaging 1.00
Z1176:Agbl4 UTSW 4 111526643 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGCCATAAGGATCAAAGTGG -3'
(R):5'- CATGCCCAAGCCAACATTTG -3'

Sequencing Primer
(F):5'- CTCTCTCTGGGAGACAATAAGTG -3'
(R):5'- CCCAAGCCAACATTTGAGTAGTGG -3'
Posted On 2016-07-22