Incidental Mutation 'R5297:Or2a12'
ID 405471
Institutional Source Beutler Lab
Gene Symbol Or2a12
Ensembl Gene ENSMUSG00000073111
Gene Name olfactory receptor family 2 subfamily A member 12
Synonyms MOR261-12, GA_x6K02T2P3E9-4632269-4631343, Olfr446
MMRRC Submission 042880-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.148) question?
Stock # R5297 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 42904167-42905093 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 42904371 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 69 (S69P)
Ref Sequence ENSEMBL: ENSMUSP00000150255 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000101461] [ENSMUST00000215369] [ENSMUST00000215686] [ENSMUST00000216199]
AlphaFold Q8VEV0
Predicted Effect probably benign
Transcript: ENSMUST00000101461
AA Change: S69P

PolyPhen 2 Score 0.172 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000099005
Gene: ENSMUSG00000073111
AA Change: S69P

DomainStartEndE-ValueType
Pfam:7tm_4 28 305 1.7e-62 PFAM
Pfam:7TM_GPCR_Srsx 32 282 1.7e-5 PFAM
Pfam:7tm_1 38 287 3.2e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215369
AA Change: S69P

PolyPhen 2 Score 0.172 (Sensitivity: 0.92; Specificity: 0.87)
Predicted Effect probably benign
Transcript: ENSMUST00000215686
AA Change: S69P

PolyPhen 2 Score 0.172 (Sensitivity: 0.92; Specificity: 0.87)
Predicted Effect probably benign
Transcript: ENSMUST00000216199
AA Change: S69P

PolyPhen 2 Score 0.172 (Sensitivity: 0.92; Specificity: 0.87)
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acbd6 G T 1: 155,463,204 (GRCm39) A135S probably benign Het
Agbl4 A G 4: 111,423,895 (GRCm39) K307R possibly damaging Het
Akna T C 4: 63,300,083 (GRCm39) E653G possibly damaging Het
Arhgap26 T C 18: 39,254,941 (GRCm39) Y273H probably damaging Het
Atg14 G A 14: 47,805,656 (GRCm39) R70C probably damaging Het
Atp1a1 C T 3: 101,498,443 (GRCm39) V250M possibly damaging Het
Cacna1c T G 6: 118,719,322 (GRCm39) D215A probably damaging Het
Cadps T A 14: 12,822,345 (GRCm38) N132Y probably damaging Het
Casp6 T C 3: 129,704,204 (GRCm39) F97L possibly damaging Het
Ckap2l T C 2: 129,127,290 (GRCm39) N296S possibly damaging Het
Col6a4 T C 9: 105,952,066 (GRCm39) K611E probably benign Het
Copa A G 1: 171,940,675 (GRCm39) H696R probably damaging Het
Cyp2a4 T A 7: 26,011,629 (GRCm39) N283K probably benign Het
Dcc C T 18: 71,511,809 (GRCm39) V869I probably benign Het
Efemp1 G T 11: 28,817,868 (GRCm39) G116C probably damaging Het
F830045P16Rik T C 2: 129,302,473 (GRCm39) E373G probably benign Het
Fbxo9 T C 9: 77,993,561 (GRCm39) T318A probably benign Het
Gipr A G 7: 18,891,469 (GRCm39) W403R probably damaging Het
Gm4787 G C 12: 81,424,604 (GRCm39) T518S probably benign Het
Golgb1 G A 16: 36,695,978 (GRCm39) probably benign Het
Hdac1-ps A G 17: 78,800,187 (GRCm39) S393G probably benign Het
Herc3 T C 6: 58,833,626 (GRCm39) L171P probably damaging Het
Il5ra A G 6: 106,715,095 (GRCm39) I221T probably benign Het
Itgb2 A G 10: 77,400,501 (GRCm39) I705V probably damaging Het
Map4k4 G T 1: 40,001,377 (GRCm39) V55F probably damaging Het
Mast1 A G 8: 85,639,947 (GRCm39) probably null Het
Mitf G T 6: 97,971,391 (GRCm39) G186V probably benign Het
Mtpn C T 6: 35,489,225 (GRCm39) D100N probably benign Het
Nrcam T C 12: 44,591,567 (GRCm39) F204L probably damaging Het
Or10g1 A G 14: 52,647,675 (GRCm39) L218P probably damaging Het
Or10x4 A G 1: 174,218,766 (GRCm39) M44V probably benign Het
Or1e16 AGCGGTCGTAGGC AGC 11: 73,286,480 (GRCm39) probably null Het
Or1e22 A T 11: 73,377,215 (GRCm39) V145E probably damaging Het
Or52n4b A T 7: 108,144,611 (GRCm39) N291I probably damaging Het
Or5as1 T C 2: 86,980,793 (GRCm39) I71V probably benign Het
Pclo A T 5: 14,726,263 (GRCm39) probably benign Het
Pik3ca T A 3: 32,504,202 (GRCm39) Y631N probably damaging Het
Pramel19 T A 4: 101,798,348 (GRCm39) D106E possibly damaging Het
Ptk2b T C 14: 66,409,966 (GRCm39) D462G probably benign Het
Rnf19a A G 15: 36,247,924 (GRCm39) S427P probably damaging Het
Scn3a T A 2: 65,299,378 (GRCm39) Y1376F possibly damaging Het
Shoc1 A G 4: 59,047,543 (GRCm39) W1359R probably benign Het
Spem1 A G 11: 69,711,753 (GRCm39) Y304H probably damaging Het
Stk38l C A 6: 146,677,153 (GRCm39) Y450* probably null Het
Stx19 A G 16: 62,642,337 (GRCm39) E51G probably damaging Het
Ttc41 C G 10: 86,612,443 (GRCm39) Q1239E probably benign Het
Tuba3a C T 6: 125,258,303 (GRCm39) R229H probably damaging Het
Utp18 A T 11: 93,766,915 (GRCm39) V264D probably damaging Het
V1rd19 T C 7: 23,702,714 (GRCm39) V60A probably damaging Het
Virma T G 4: 11,494,819 (GRCm39) V40G probably damaging Het
Vmn1r160 C T 7: 22,570,715 (GRCm39) Q23* probably null Het
Vmn2r13 T C 5: 109,339,805 (GRCm39) I57V probably benign Het
Vmn2r26 T A 6: 124,038,832 (GRCm39) F802L probably damaging Het
Vmn2r61 A G 7: 41,909,646 (GRCm39) D57G probably benign Het
Vps13c A G 9: 67,785,413 (GRCm39) N260S probably damaging Het
Xirp1 C A 9: 119,848,668 (GRCm39) A72S probably damaging Het
Zfp212 T C 6: 47,906,011 (GRCm39) V190A probably benign Het
Zfp703 C T 8: 27,469,233 (GRCm39) P299L probably damaging Het
Other mutations in Or2a12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02947:Or2a12 APN 6 42,904,830 (GRCm39) missense probably benign 0.24
IGL03164:Or2a12 APN 6 42,905,064 (GRCm39) nonsense probably null
PIT4519001:Or2a12 UTSW 6 42,904,578 (GRCm39) missense probably damaging 1.00
R1760:Or2a12 UTSW 6 42,904,431 (GRCm39) missense possibly damaging 0.90
R1883:Or2a12 UTSW 6 42,904,764 (GRCm39) missense probably damaging 0.99
R1884:Or2a12 UTSW 6 42,904,764 (GRCm39) missense probably damaging 0.99
R2180:Or2a12 UTSW 6 42,904,459 (GRCm39) missense probably benign 0.14
R3001:Or2a12 UTSW 6 42,904,888 (GRCm39) missense probably damaging 1.00
R3002:Or2a12 UTSW 6 42,904,888 (GRCm39) missense probably damaging 1.00
R4435:Or2a12 UTSW 6 42,905,023 (GRCm39) missense probably damaging 1.00
R4544:Or2a12 UTSW 6 42,904,348 (GRCm39) missense probably damaging 1.00
R4546:Or2a12 UTSW 6 42,904,348 (GRCm39) missense probably damaging 1.00
R5009:Or2a12 UTSW 6 42,904,367 (GRCm39) missense probably damaging 1.00
R5236:Or2a12 UTSW 6 42,904,715 (GRCm39) missense probably benign 0.04
R5290:Or2a12 UTSW 6 42,904,972 (GRCm39) missense probably damaging 0.98
R7371:Or2a12 UTSW 6 42,904,469 (GRCm39) nonsense probably null
R9308:Or2a12 UTSW 6 42,904,749 (GRCm39) missense probably benign 0.14
R9364:Or2a12 UTSW 6 42,904,534 (GRCm39) missense probably damaging 1.00
R9404:Or2a12 UTSW 6 42,904,750 (GRCm39) missense probably benign 0.14
X0065:Or2a12 UTSW 6 42,904,990 (GRCm39) missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- CAGACATGGATCACTGAGGTC -3'
(R):5'- TCCAGCTCATGATCAGTGTG -3'

Sequencing Primer
(F):5'- GACATGGATCACTGAGGTCATTCTAC -3'
(R):5'- CAGCTCATGATCAGTGTGTATTTC -3'
Posted On 2016-07-22