Incidental Mutation 'R5297:Vmn2r26'
ID 405477
Institutional Source Beutler Lab
Gene Symbol Vmn2r26
Ensembl Gene ENSMUSG00000096630
Gene Name vomeronasal 2, receptor 26
Synonyms V2r1b
MMRRC Submission 042880-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.094) question?
Stock # R5297 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 124001717-124038994 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 124038832 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 802 (F802L)
Ref Sequence ENSEMBL: ENSMUSP00000032238 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032238]
AlphaFold Q6TAC4
Predicted Effect probably damaging
Transcript: ENSMUST00000032238
AA Change: F802L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000032238
Gene: ENSMUSG00000096630
AA Change: F802L

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ANF_receptor 82 471 1.5e-31 PFAM
Pfam:NCD3G 519 572 4.6e-25 PFAM
Pfam:7tm_3 603 840 1.5e-55 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158682
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal vomeronasal sensory neuron physiology and avnosmia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acbd6 G T 1: 155,463,204 (GRCm39) A135S probably benign Het
Agbl4 A G 4: 111,423,895 (GRCm39) K307R possibly damaging Het
Akna T C 4: 63,300,083 (GRCm39) E653G possibly damaging Het
Arhgap26 T C 18: 39,254,941 (GRCm39) Y273H probably damaging Het
Atg14 G A 14: 47,805,656 (GRCm39) R70C probably damaging Het
Atp1a1 C T 3: 101,498,443 (GRCm39) V250M possibly damaging Het
Cacna1c T G 6: 118,719,322 (GRCm39) D215A probably damaging Het
Cadps T A 14: 12,822,345 (GRCm38) N132Y probably damaging Het
Casp6 T C 3: 129,704,204 (GRCm39) F97L possibly damaging Het
Ckap2l T C 2: 129,127,290 (GRCm39) N296S possibly damaging Het
Col6a4 T C 9: 105,952,066 (GRCm39) K611E probably benign Het
Copa A G 1: 171,940,675 (GRCm39) H696R probably damaging Het
Cyp2a4 T A 7: 26,011,629 (GRCm39) N283K probably benign Het
Dcc C T 18: 71,511,809 (GRCm39) V869I probably benign Het
Efemp1 G T 11: 28,817,868 (GRCm39) G116C probably damaging Het
F830045P16Rik T C 2: 129,302,473 (GRCm39) E373G probably benign Het
Fbxo9 T C 9: 77,993,561 (GRCm39) T318A probably benign Het
Gipr A G 7: 18,891,469 (GRCm39) W403R probably damaging Het
Gm4787 G C 12: 81,424,604 (GRCm39) T518S probably benign Het
Golgb1 G A 16: 36,695,978 (GRCm39) probably benign Het
Hdac1-ps A G 17: 78,800,187 (GRCm39) S393G probably benign Het
Herc3 T C 6: 58,833,626 (GRCm39) L171P probably damaging Het
Il5ra A G 6: 106,715,095 (GRCm39) I221T probably benign Het
Itgb2 A G 10: 77,400,501 (GRCm39) I705V probably damaging Het
Map4k4 G T 1: 40,001,377 (GRCm39) V55F probably damaging Het
Mast1 A G 8: 85,639,947 (GRCm39) probably null Het
Mitf G T 6: 97,971,391 (GRCm39) G186V probably benign Het
Mtpn C T 6: 35,489,225 (GRCm39) D100N probably benign Het
Nrcam T C 12: 44,591,567 (GRCm39) F204L probably damaging Het
Or10g1 A G 14: 52,647,675 (GRCm39) L218P probably damaging Het
Or10x4 A G 1: 174,218,766 (GRCm39) M44V probably benign Het
Or1e16 AGCGGTCGTAGGC AGC 11: 73,286,480 (GRCm39) probably null Het
Or1e22 A T 11: 73,377,215 (GRCm39) V145E probably damaging Het
Or2a12 T C 6: 42,904,371 (GRCm39) S69P probably benign Het
Or52n4b A T 7: 108,144,611 (GRCm39) N291I probably damaging Het
Or5as1 T C 2: 86,980,793 (GRCm39) I71V probably benign Het
Pclo A T 5: 14,726,263 (GRCm39) probably benign Het
Pik3ca T A 3: 32,504,202 (GRCm39) Y631N probably damaging Het
Pramel19 T A 4: 101,798,348 (GRCm39) D106E possibly damaging Het
Ptk2b T C 14: 66,409,966 (GRCm39) D462G probably benign Het
Rnf19a A G 15: 36,247,924 (GRCm39) S427P probably damaging Het
Scn3a T A 2: 65,299,378 (GRCm39) Y1376F possibly damaging Het
Shoc1 A G 4: 59,047,543 (GRCm39) W1359R probably benign Het
Spem1 A G 11: 69,711,753 (GRCm39) Y304H probably damaging Het
Stk38l C A 6: 146,677,153 (GRCm39) Y450* probably null Het
Stx19 A G 16: 62,642,337 (GRCm39) E51G probably damaging Het
Ttc41 C G 10: 86,612,443 (GRCm39) Q1239E probably benign Het
Tuba3a C T 6: 125,258,303 (GRCm39) R229H probably damaging Het
Utp18 A T 11: 93,766,915 (GRCm39) V264D probably damaging Het
V1rd19 T C 7: 23,702,714 (GRCm39) V60A probably damaging Het
Virma T G 4: 11,494,819 (GRCm39) V40G probably damaging Het
Vmn1r160 C T 7: 22,570,715 (GRCm39) Q23* probably null Het
Vmn2r13 T C 5: 109,339,805 (GRCm39) I57V probably benign Het
Vmn2r61 A G 7: 41,909,646 (GRCm39) D57G probably benign Het
Vps13c A G 9: 67,785,413 (GRCm39) N260S probably damaging Het
Xirp1 C A 9: 119,848,668 (GRCm39) A72S probably damaging Het
Zfp212 T C 6: 47,906,011 (GRCm39) V190A probably benign Het
Zfp703 C T 8: 27,469,233 (GRCm39) P299L probably damaging Het
Other mutations in Vmn2r26
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01070:Vmn2r26 APN 6 124,038,566 (GRCm39) missense probably benign 0.00
IGL01370:Vmn2r26 APN 6 124,038,715 (GRCm39) missense probably benign 0.08
IGL01603:Vmn2r26 APN 6 124,030,833 (GRCm39) missense probably damaging 1.00
IGL01651:Vmn2r26 APN 6 124,027,632 (GRCm39) missense probably benign 0.01
IGL02282:Vmn2r26 APN 6 124,038,584 (GRCm39) missense probably damaging 1.00
IGL02425:Vmn2r26 APN 6 124,038,777 (GRCm39) missense probably damaging 1.00
IGL02551:Vmn2r26 APN 6 124,003,100 (GRCm39) missense probably benign 0.11
IGL02690:Vmn2r26 APN 6 124,003,091 (GRCm39) missense probably benign 0.14
IGL03002:Vmn2r26 APN 6 124,016,754 (GRCm39) missense possibly damaging 0.78
IGL03270:Vmn2r26 APN 6 124,027,778 (GRCm39) missense probably benign 0.16
R0032:Vmn2r26 UTSW 6 124,016,858 (GRCm39) missense possibly damaging 0.72
R0052:Vmn2r26 UTSW 6 124,038,992 (GRCm39) makesense probably null
R0083:Vmn2r26 UTSW 6 124,030,940 (GRCm39) splice site probably null
R0682:Vmn2r26 UTSW 6 124,038,129 (GRCm39) missense probably damaging 0.97
R1061:Vmn2r26 UTSW 6 124,038,603 (GRCm39) missense probably benign 0.12
R1077:Vmn2r26 UTSW 6 124,030,872 (GRCm39) missense probably benign 0.00
R1263:Vmn2r26 UTSW 6 124,027,667 (GRCm39) missense probably benign
R1579:Vmn2r26 UTSW 6 124,016,706 (GRCm39) missense probably benign 0.00
R1741:Vmn2r26 UTSW 6 124,038,431 (GRCm39) missense probably damaging 1.00
R1834:Vmn2r26 UTSW 6 124,038,369 (GRCm39) missense possibly damaging 0.54
R1838:Vmn2r26 UTSW 6 124,001,730 (GRCm39) missense probably benign
R1956:Vmn2r26 UTSW 6 124,030,846 (GRCm39) missense probably damaging 1.00
R1996:Vmn2r26 UTSW 6 124,038,144 (GRCm39) missense probably damaging 1.00
R2140:Vmn2r26 UTSW 6 124,038,196 (GRCm39) missense probably benign 0.01
R2327:Vmn2r26 UTSW 6 124,016,708 (GRCm39) missense probably benign 0.07
R2417:Vmn2r26 UTSW 6 124,038,309 (GRCm39) missense probably damaging 1.00
R3930:Vmn2r26 UTSW 6 124,002,938 (GRCm39) missense probably benign
R4490:Vmn2r26 UTSW 6 124,027,697 (GRCm39) missense possibly damaging 0.47
R4629:Vmn2r26 UTSW 6 124,038,150 (GRCm39) missense possibly damaging 0.50
R4655:Vmn2r26 UTSW 6 124,038,375 (GRCm39) missense probably damaging 1.00
R4709:Vmn2r26 UTSW 6 124,030,924 (GRCm39) missense probably damaging 1.00
R4992:Vmn2r26 UTSW 6 124,003,070 (GRCm39) missense probably benign 0.00
R5482:Vmn2r26 UTSW 6 124,038,285 (GRCm39) missense possibly damaging 0.88
R5517:Vmn2r26 UTSW 6 124,027,676 (GRCm39) missense probably damaging 1.00
R5737:Vmn2r26 UTSW 6 124,016,408 (GRCm39) missense probably benign 0.00
R5739:Vmn2r26 UTSW 6 124,002,925 (GRCm39) missense probably benign 0.00
R5873:Vmn2r26 UTSW 6 124,038,633 (GRCm39) missense probably benign 0.01
R5907:Vmn2r26 UTSW 6 124,016,830 (GRCm39) missense probably benign 0.00
R6086:Vmn2r26 UTSW 6 124,016,519 (GRCm39) missense possibly damaging 0.48
R6134:Vmn2r26 UTSW 6 124,038,444 (GRCm39) missense probably damaging 0.97
R6391:Vmn2r26 UTSW 6 124,038,348 (GRCm39) missense probably damaging 1.00
R6428:Vmn2r26 UTSW 6 124,003,039 (GRCm39) missense probably benign 0.17
R6637:Vmn2r26 UTSW 6 124,038,650 (GRCm39) missense probably damaging 1.00
R6927:Vmn2r26 UTSW 6 124,016,057 (GRCm39) missense possibly damaging 0.93
R6953:Vmn2r26 UTSW 6 124,016,741 (GRCm39) missense probably benign 0.00
R7173:Vmn2r26 UTSW 6 124,038,255 (GRCm39) missense probably benign 0.16
R7206:Vmn2r26 UTSW 6 124,016,727 (GRCm39) missense probably benign 0.17
R7208:Vmn2r26 UTSW 6 124,038,948 (GRCm39) missense probably damaging 1.00
R7283:Vmn2r26 UTSW 6 124,002,914 (GRCm39) missense probably damaging 0.97
R7506:Vmn2r26 UTSW 6 124,016,700 (GRCm39) missense probably benign 0.00
R7672:Vmn2r26 UTSW 6 124,016,606 (GRCm39) missense probably benign 0.25
R7674:Vmn2r26 UTSW 6 124,016,321 (GRCm39) missense probably benign
R7696:Vmn2r26 UTSW 6 124,038,494 (GRCm39) missense possibly damaging 0.94
R7716:Vmn2r26 UTSW 6 124,038,704 (GRCm39) missense probably damaging 1.00
R7831:Vmn2r26 UTSW 6 124,016,758 (GRCm39) nonsense probably null
R8063:Vmn2r26 UTSW 6 124,001,914 (GRCm39) missense probably benign 0.00
R8331:Vmn2r26 UTSW 6 124,038,887 (GRCm39) missense probably benign 0.22
R8352:Vmn2r26 UTSW 6 124,016,577 (GRCm39) missense probably benign 0.09
R8445:Vmn2r26 UTSW 6 124,002,995 (GRCm39) missense probably damaging 0.97
R8452:Vmn2r26 UTSW 6 124,016,577 (GRCm39) missense probably benign 0.09
R8681:Vmn2r26 UTSW 6 124,001,877 (GRCm39) missense probably benign 0.00
R8914:Vmn2r26 UTSW 6 124,038,983 (GRCm39) missense probably benign
R9333:Vmn2r26 UTSW 6 124,003,009 (GRCm39) missense probably benign 0.13
R9351:Vmn2r26 UTSW 6 124,016,333 (GRCm39) missense probably benign
R9436:Vmn2r26 UTSW 6 124,002,826 (GRCm39) missense probably damaging 1.00
R9515:Vmn2r26 UTSW 6 124,038,137 (GRCm39) missense probably damaging 1.00
RF010:Vmn2r26 UTSW 6 124,016,448 (GRCm39) missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- ATCATTCTCTGGTGTAACGAGGG -3'
(R):5'- TTGACTACACATGACACGTTTG -3'

Sequencing Primer
(F):5'- TGGTGTAACGAGGGGTCCAC -3'
(R):5'- TCCTTTGTCTTAAGGAGGAAGTC -3'
Posted On 2016-07-22