Mutagenetix > Incidental Mutation

Incidental Mutation 'R5297:Vmn2r26'

405477

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r26

Ensembl Gene

ENSMUSG00000096630

Gene Name

vomeronasal 2, receptor 26

Synonyms

V2r1b

MMRRC Submission

042880-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.102) question?

Stock #

R5297 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

124024758-124062035 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 124061873 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Leucine at position 802 (F802L)

Ref Sequence

ENSEMBL: ENSMUSP00000032238 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000032238]

AlphaFold

Q6TAC4

Predicted Effect

probably damaging
Transcript: ENSMUST00000032238
AA Change: F802L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000032238
Gene: ENSMUSG00000096630
AA Change: F802L

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:ANF_receptor	82	471	1.5e-31	PFAM
Pfam:NCD3G	519	572	4.6e-25	PFAM
Pfam:7tm_3	603	840	1.5e-55	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000158682

Coding Region Coverage

1x: 99.4%
3x: 98.7%
10x: 97.4%
20x: 95.6%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal vomeronasal sensory neuron physiology and avnosmia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acbd6	G	T	1: 155,587,458	A135S	probably benign	Het
Agbl4	A	G	4: 111,566,698	K307R	possibly damaging	Het
AI481877	A	G	4: 59,047,543	W1359R	probably benign	Het
Akna	T	C	4: 63,381,846	E653G	possibly damaging	Het
Arhgap26	T	C	18: 39,121,888	Y273H	probably damaging	Het
Atg14	G	A	14: 47,568,199	R70C	probably damaging	Het
Atp1a1	C	T	3: 101,591,127	V250M	possibly damaging	Het
Cacna1c	T	G	6: 118,742,361	D215A	probably damaging	Het
Cadps	T	A	14: 12,822,345	N132Y	probably damaging	Het
Casp6	T	C	3: 129,910,555	F97L	possibly damaging	Het
Ckap2l	T	C	2: 129,285,370	N296S	possibly damaging	Het
Col6a4	T	C	9: 106,074,867	K611E	probably benign	Het
Copa	A	G	1: 172,113,108	H696R	probably damaging	Het
Cyp2a4	T	A	7: 26,312,204	N283K	probably benign	Het
Dcc	C	T	18: 71,378,738	V869I	probably benign	Het
Efemp1	G	T	11: 28,867,868	G116C	probably damaging	Het
F830045P16Rik	T	C	2: 129,460,553	E373G	probably benign	Het
Fbxo9	T	C	9: 78,086,279	T318A	probably benign	Het
Gipr	A	G	7: 19,157,544	W403R	probably damaging	Het
Gm10093	A	G	17: 78,492,758	S393G	probably benign	Het
Gm12794	T	A	4: 101,941,151	D106E	possibly damaging	Het
Gm4787	G	C	12: 81,377,830	T518S	probably benign	Het
Golgb1	G	A	16: 36,875,616		probably benign	Het
Herc3	T	C	6: 58,856,641	L171P	probably damaging	Het
Il5ra	A	G	6: 106,738,134	I221T	probably benign	Het
Itgb2	A	G	10: 77,564,667	I705V	probably damaging	Het
Map4k4	G	T	1: 39,962,217	V55F	probably damaging	Het
Mast1	A	G	8: 84,913,318		probably null	Het
Mitf	G	T	6: 97,994,430	G186V	probably benign	Het
Mtpn	C	T	6: 35,512,290	D100N	probably benign	Het
Nrcam	T	C	12: 44,544,784	F204L	probably damaging	Het
Olfr1	AGCGGTCGTAGGC	AGC	11: 73,395,654		probably null	Het
Olfr1111	T	C	2: 87,150,449	I71V	probably benign	Het
Olfr1510	A	G	14: 52,410,218	L218P	probably damaging	Het
Olfr248	A	G	1: 174,391,200	M44V	probably benign	Het
Olfr381	A	T	11: 73,486,389	V145E	probably damaging	Het
Olfr446	T	C	6: 42,927,437	S69P	probably benign	Het
Olfr503	A	T	7: 108,545,404	N291I	probably damaging	Het
Pclo	A	T	5: 14,676,249		probably benign	Het
Pik3ca	T	A	3: 32,450,053	Y631N	probably damaging	Het
Ptk2b	T	C	14: 66,172,517	D462G	probably benign	Het
Rnf19a	A	G	15: 36,247,778	S427P	probably damaging	Het
Scn3a	T	A	2: 65,469,034	Y1376F	possibly damaging	Het
Spem1	A	G	11: 69,820,927	Y304H	probably damaging	Het
Stk38l	C	A	6: 146,775,655	Y450*	probably null	Het
Stx19	A	G	16: 62,821,974	E51G	probably damaging	Het
Ttc41	C	G	10: 86,776,579	Q1239E	probably benign	Het
Tuba3a	C	T	6: 125,281,340	R229H	probably damaging	Het
Utp18	A	T	11: 93,876,089	V264D	probably damaging	Het
V1rd19	T	C	7: 24,003,289	V60A	probably damaging	Het
Virma	T	G	4: 11,494,819	V40G	probably damaging	Het
Vmn1r160	C	T	7: 22,871,290	Q23*	probably null	Het
Vmn2r13	T	C	5: 109,191,939	I57V	probably benign	Het
Vmn2r61	A	G	7: 42,260,222	D57G	probably benign	Het
Vps13c	A	G	9: 67,878,131	N260S	probably damaging	Het
Xirp1	C	A	9: 120,019,602	A72S	probably damaging	Het
Zfp212	T	C	6: 47,929,077	V190A	probably benign	Het
Zfp703	C	T	8: 26,979,205	P299L	probably damaging	Het

Other mutations in Vmn2r26

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01070:Vmn2r26	APN	6	124061607	missense	probably benign	0.00
IGL01370:Vmn2r26	APN	6	124061756	missense	probably benign	0.08
IGL01603:Vmn2r26	APN	6	124053874	missense	probably damaging	1.00
IGL01651:Vmn2r26	APN	6	124050673	missense	probably benign	0.01
IGL02282:Vmn2r26	APN	6	124061625	missense	probably damaging	1.00
IGL02425:Vmn2r26	APN	6	124061818	missense	probably damaging	1.00
IGL02551:Vmn2r26	APN	6	124026141	missense	probably benign	0.11
IGL02690:Vmn2r26	APN	6	124026132	missense	probably benign	0.14
IGL03002:Vmn2r26	APN	6	124039795	missense	possibly damaging	0.78
IGL03270:Vmn2r26	APN	6	124050819	missense	probably benign	0.16
R0032:Vmn2r26	UTSW	6	124039899	missense	possibly damaging	0.72
R0052:Vmn2r26	UTSW	6	124062033	makesense	probably null
R0083:Vmn2r26	UTSW	6	124053981	splice site	probably null
R0682:Vmn2r26	UTSW	6	124061170	missense	probably damaging	0.97
R1061:Vmn2r26	UTSW	6	124061644	missense	probably benign	0.12
R1077:Vmn2r26	UTSW	6	124053913	missense	probably benign	0.00
R1263:Vmn2r26	UTSW	6	124050708	missense	probably benign
R1579:Vmn2r26	UTSW	6	124039747	missense	probably benign	0.00
R1741:Vmn2r26	UTSW	6	124061472	missense	probably damaging	1.00
R1834:Vmn2r26	UTSW	6	124061410	missense	possibly damaging	0.54
R1838:Vmn2r26	UTSW	6	124024771	missense	probably benign
R1956:Vmn2r26	UTSW	6	124053887	missense	probably damaging	1.00
R1996:Vmn2r26	UTSW	6	124061185	missense	probably damaging	1.00
R2140:Vmn2r26	UTSW	6	124061237	missense	probably benign	0.01
R2327:Vmn2r26	UTSW	6	124039749	missense	probably benign	0.07
R2417:Vmn2r26	UTSW	6	124061350	missense	probably damaging	1.00
R3930:Vmn2r26	UTSW	6	124025979	missense	probably benign
R4490:Vmn2r26	UTSW	6	124050738	missense	possibly damaging	0.47
R4629:Vmn2r26	UTSW	6	124061191	missense	possibly damaging	0.50
R4655:Vmn2r26	UTSW	6	124061416	missense	probably damaging	1.00
R4709:Vmn2r26	UTSW	6	124053965	missense	probably damaging	1.00
R4992:Vmn2r26	UTSW	6	124026111	missense	probably benign	0.00
R5482:Vmn2r26	UTSW	6	124061326	missense	possibly damaging	0.88
R5517:Vmn2r26	UTSW	6	124050717	missense	probably damaging	1.00
R5737:Vmn2r26	UTSW	6	124039449	missense	probably benign	0.00
R5739:Vmn2r26	UTSW	6	124025966	missense	probably benign	0.00
R5873:Vmn2r26	UTSW	6	124061674	missense	probably benign	0.01
R5907:Vmn2r26	UTSW	6	124039871	missense	probably benign	0.00
R6086:Vmn2r26	UTSW	6	124039560	missense	possibly damaging	0.48
R6134:Vmn2r26	UTSW	6	124061485	missense	probably damaging	0.97
R6391:Vmn2r26	UTSW	6	124061389	missense	probably damaging	1.00
R6428:Vmn2r26	UTSW	6	124026080	missense	probably benign	0.17
R6637:Vmn2r26	UTSW	6	124061691	missense	probably damaging	1.00
R6927:Vmn2r26	UTSW	6	124039098	missense	possibly damaging	0.93
R6953:Vmn2r26	UTSW	6	124039782	missense	probably benign	0.00
R7173:Vmn2r26	UTSW	6	124061296	missense	probably benign	0.16
R7206:Vmn2r26	UTSW	6	124039768	missense	probably benign	0.17
R7208:Vmn2r26	UTSW	6	124061989	missense	probably damaging	1.00
R7283:Vmn2r26	UTSW	6	124025955	missense	probably damaging	0.97
R7506:Vmn2r26	UTSW	6	124039741	missense	probably benign	0.00
R7672:Vmn2r26	UTSW	6	124039647	missense	probably benign	0.25
R7674:Vmn2r26	UTSW	6	124039362	missense	probably benign
R7696:Vmn2r26	UTSW	6	124061535	missense	possibly damaging	0.94
R7716:Vmn2r26	UTSW	6	124061745	missense	probably damaging	1.00
R7831:Vmn2r26	UTSW	6	124039799	nonsense	probably null
R8063:Vmn2r26	UTSW	6	124024955	missense	probably benign	0.00
R8331:Vmn2r26	UTSW	6	124061928	missense	probably benign	0.22
R8352:Vmn2r26	UTSW	6	124039618	missense	probably benign	0.09
R8445:Vmn2r26	UTSW	6	124026036	missense	probably damaging	0.97
R8452:Vmn2r26	UTSW	6	124039618	missense	probably benign	0.09
R8681:Vmn2r26	UTSW	6	124024918	missense	probably benign	0.00
R8914:Vmn2r26	UTSW	6	124062024	missense	probably benign
R9333:Vmn2r26	UTSW	6	124026050	missense	probably benign	0.13
R9351:Vmn2r26	UTSW	6	124039374	missense	probably benign
R9436:Vmn2r26	UTSW	6	124025867	missense	probably damaging	1.00
R9515:Vmn2r26	UTSW	6	124061178	missense	probably damaging	1.00
RF010:Vmn2r26	UTSW	6	124039489	missense	possibly damaging	0.90

Predicted Primers

PCR Primer
(F):5'- ATCATTCTCTGGTGTAACGAGGG -3'
(R):5'- TTGACTACACATGACACGTTTG -3'

Sequencing Primer
(F):5'- TGGTGTAACGAGGGGTCCAC -3'
(R):5'- TCCTTTGTCTTAAGGAGGAAGTC -3'

Posted On

2016-07-22