Mutagenetix > Incidental Mutation

Incidental Mutation 'R0497:Gucy2e'

40549

Institutional Source

Beutler Lab

Gene Symbol

Gucy2e

Ensembl Gene

ENSMUSG00000020890

Gene Name

guanylate cyclase 2e

Synonyms

GC1, GC-E, ROS-GC1

MMRRC Submission

038693-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.351) question?

Stock #

R0497 (G1)

Quality Score

118

Status

Validated

Chromosome

Chromosomal Location

69218117-69237036 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 69224159 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Glutamic Acid at position 974 (V974E)

Ref Sequence

ENSEMBL: ENSMUSP00000104305 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021259] [ENSMUST00000108664] [ENSMUST00000108665]

AlphaFold

P52785

Predicted Effect

probably damaging
Transcript: ENSMUST00000021259
AA Change: V974E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000021259
Gene: ENSMUSG00000020890
AA Change: V974E

Domain	Start	End	E-Value	Type
low complexity region	5	15	N/A	INTRINSIC
low complexity region	36	55	N/A	INTRINSIC
Pfam:ANF_receptor	75	403	5.3e-37	PFAM
transmembrane domain	468	490	N/A	INTRINSIC
Pfam:Pkinase	557	807	1.1e-24	PFAM
Pfam:Pkinase_Tyr	560	807	2e-29	PFAM
CYCc	847	1050	7.78e-104	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000108664
AA Change: V974E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000104304
Gene: ENSMUSG00000020890
AA Change: V974E

Domain	Start	End	E-Value	Type
low complexity region	5	15	N/A	INTRINSIC
low complexity region	36	55	N/A	INTRINSIC
Pfam:ANF_receptor	75	403	2.4e-40	PFAM
transmembrane domain	468	490	N/A	INTRINSIC
Pfam:Pkinase	560	807	9.5e-23	PFAM
Pfam:Pkinase_Tyr	560	807	7.7e-29	PFAM
CYCc	847	1050	7.78e-104	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000108665
AA Change: V974E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000104305
Gene: ENSMUSG00000020890
AA Change: V974E

Domain	Start	End	E-Value	Type
low complexity region	5	15	N/A	INTRINSIC
low complexity region	36	55	N/A	INTRINSIC
Pfam:ANF_receptor	75	403	5.3e-37	PFAM
transmembrane domain	468	490	N/A	INTRINSIC
Pfam:Pkinase	557	807	1.1e-24	PFAM
Pfam:Pkinase_Tyr	560	807	2e-29	PFAM
CYCc	847	1050	7.78e-104	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155457

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.6%
3x: 98.7%
10x: 96.6%
20x: 93.1%

Validation Efficiency

100% (68/68)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a retina-specific guanylate cyclase, which is a member of the membrane guanylyl cyclase family. Like other membrane guanylyl cyclases, this enzyme has a hydrophobic amino-terminal signal sequence followed by a large extracellular domain, a single membrane spanning domain, a kinase homology domain, and a guanylyl cyclase catalytic domain. In contrast to other membrane guanylyl cyclases, this enzyme is not activated by natriuretic peptides. Mutations in this gene result in Leber congenital amaurosis and cone-rod dystrophy-6 diseases. [provided by RefSeq, Dec 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal retinal cone cell morphology, impaired cone and rod electrophysiology, and severe retinal cone cell degeneration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9530053A07Rik	T	A	7: 28,147,465	C1158S	probably damaging	Het
Aatk	A	C	11: 120,018,780	V110G	probably damaging	Het
Adcy6	A	C	15: 98,597,725		probably null	Het
Adm	A	G	7: 110,629,121	T170A	probably benign	Het
Afap1l2	G	T	19: 56,930,209	N171K	probably benign	Het
Aph1b	G	T	9: 66,790,618	S112*	probably null	Het
Arhgap23	A	G	11: 97,452,163	S424G	probably damaging	Het
Asah2	T	A	19: 32,054,631	N46I	probably benign	Het
Braf	G	A	6: 39,640,549		probably benign	Het
Brd2	C	T	17: 34,114,360	R47Q	probably damaging	Het
C2cd5	A	G	6: 143,012,093	V972A	probably benign	Het
Car9	T	A	4: 43,511,881	L300H	probably damaging	Het
Chmp3	T	C	6: 71,552,411	S20P	probably damaging	Het
Chp1	A	G	2: 119,571,782	N79S	possibly damaging	Het
Cnot2	A	T	10: 116,498,355	I335N	probably damaging	Het
Cntnap4	T	C	8: 112,570,151	V6A	probably benign	Het
Ctcf	T	A	8: 105,675,040		probably benign	Het
Dennd1b	A	G	1: 139,039,986		probably benign	Het
Dirc2	A	T	16: 35,735,604	V162D	probably benign	Het
Dnmbp	A	G	19: 43,856,640		probably benign	Het
Eef2	T	C	10: 81,181,586	F782L	probably benign	Het
Eogt	T	A	6: 97,135,233	Y153F	probably benign	Het
Fam81a	G	T	9: 70,096,119	Q237K	possibly damaging	Het
Fat2	T	A	11: 55,283,402	T2162S	probably benign	Het
Gas6	T	C	8: 13,470,387	I434V	possibly damaging	Het
Gm42417	A	T	1: 36,532,167	L77Q	probably damaging	Het
Grik3	A	T	4: 125,623,510	N49Y	possibly damaging	Het
Helz2	A	G	2: 181,229,656	V2721A	probably damaging	Het
Klhl6	GT	G	16: 19,956,966	279	probably null	Het
Krt73	A	G	15: 101,802,230	L23P	probably damaging	Het
L3mbtl3	T	C	10: 26,282,874		probably benign	Het
Lrrc15	A	T	16: 30,272,892	V543E	probably damaging	Het
Med13	G	A	11: 86,276,983		probably benign	Het
Med25	T	C	7: 44,892,100	D60G	probably damaging	Het
Mgam	T	A	6: 40,664,892	Y560N	probably damaging	Het
Mlkl	A	G	8: 111,327,873	Y211H	probably damaging	Het
Msl2	A	G	9: 101,101,294	N289S	probably benign	Het
Nwd2	G	T	5: 63,806,343	W1090L	probably damaging	Het
Olfr1281	A	G	2: 111,328,830	D137G	probably benign	Het
Omt2b	T	C	9: 78,328,231		probably benign	Het
Pald1	A	G	10: 61,341,315	L652P	probably damaging	Het
Pard3b	T	A	1: 62,440,008		probably null	Het
Prdm15	G	A	16: 97,794,334	T1098I	possibly damaging	Het
Rock2	A	G	12: 16,954,953	T436A	probably benign	Het
Sema4c	A	T	1: 36,549,608	D812E	probably benign	Het
Sla	A	T	15: 66,792,249	I91K	probably benign	Het
Slc22a16	T	G	10: 40,584,967	M255R	probably damaging	Het
Smg8	C	T	11: 87,086,084	D224N	possibly damaging	Het
Spdef	A	T	17: 27,718,058	D190E	probably benign	Het
Taok1	A	G	11: 77,573,804	I152T	probably damaging	Het
Tmem220	A	G	11: 67,025,922	D36G	probably damaging	Het
Tmem235	A	C	11: 117,864,351	I210L	probably benign	Het
Tmem266	C	T	9: 55,380,884		probably null	Het
Tmprss12	A	G	15: 100,281,039		probably benign	Het
Trim32	G	A	4: 65,613,254	R16Q	probably damaging	Het
Usp38	T	A	8: 80,984,424		probably benign	Het
Usp44	C	T	10: 93,846,806	P373S	possibly damaging	Het
Vmn1r209	G	T	13: 22,805,948	Q191K	probably damaging	Het
Vmn1r70	T	C	7: 10,634,026	I147T	probably benign	Het
Vmn2r107	T	A	17: 20,375,132	I649N	probably damaging	Het
Vmn2r12	A	T	5: 109,091,889	Y269*	probably null	Het
Zan	C	T	5: 137,412,676		probably benign	Het
Zfp616	G	T	11: 74,083,480	V192L	probably benign	Het
Zfp644	A	T	5: 106,638,333	V116D	probably damaging	Het
Zgrf1	T	C	3: 127,584,650		probably benign	Het
Zhx3	A	T	2: 160,779,994	L751*	probably null	Het
Znfx1	T	A	2: 167,055,411	Q531L	probably benign	Het

Other mutations in Gucy2e

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00916:Gucy2e	APN	11	69223097	missense	possibly damaging	0.88
IGL01626:Gucy2e	APN	11	69232855	missense	possibly damaging	0.80
IGL01756:Gucy2e	APN	11	69232852	missense	probably damaging	0.98
IGL02030:Gucy2e	APN	11	69223816	missense	probably damaging	1.00
IGL02095:Gucy2e	APN	11	69232787	missense	possibly damaging	0.48
IGL02387:Gucy2e	APN	11	69236116	missense	probably benign
IGL02622:Gucy2e	APN	11	69225031	missense	probably damaging	1.00
IGL02660:Gucy2e	APN	11	69232007	missense	probably benign	0.18
IGL03181:Gucy2e	APN	11	69230182	splice site	probably benign
R0110:Gucy2e	UTSW	11	69235576	missense	probably benign	0.00
R0115:Gucy2e	UTSW	11	69236632	missense	unknown
R0450:Gucy2e	UTSW	11	69235576	missense	probably benign	0.00
R0469:Gucy2e	UTSW	11	69235576	missense	probably benign	0.00
R0510:Gucy2e	UTSW	11	69235576	missense	probably benign	0.00
R1252:Gucy2e	UTSW	11	69235659	missense	probably benign
R1535:Gucy2e	UTSW	11	69226244	missense	probably damaging	1.00
R1700:Gucy2e	UTSW	11	69232058	missense	probably benign
R2035:Gucy2e	UTSW	11	69227532	missense	probably benign	0.12
R2179:Gucy2e	UTSW	11	69228578	splice site	probably null
R3622:Gucy2e	UTSW	11	69225051	missense	probably damaging	1.00
R4212:Gucy2e	UTSW	11	69228123	missense	probably damaging	0.99
R4600:Gucy2e	UTSW	11	69236168	missense	possibly damaging	0.71
R4790:Gucy2e	UTSW	11	69228448	missense	probably damaging	1.00
R5170:Gucy2e	UTSW	11	69235570	missense	probably damaging	0.97
R5174:Gucy2e	UTSW	11	69236566	missense	probably benign
R5440:Gucy2e	UTSW	11	69223646	missense	probably damaging	0.98
R5586:Gucy2e	UTSW	11	69226256	missense	probably damaging	1.00
R5668:Gucy2e	UTSW	11	69228381	missense	probably damaging	1.00
R5820:Gucy2e	UTSW	11	69232696	missense	probably benign	0.36
R5826:Gucy2e	UTSW	11	69236033	missense	possibly damaging	0.53
R6169:Gucy2e	UTSW	11	69236104	missense	probably benign	0.19
R6544:Gucy2e	UTSW	11	69235657	missense	probably benign
R6815:Gucy2e	UTSW	11	69232001	missense	possibly damaging	0.86
R7020:Gucy2e	UTSW	11	69232793	missense	probably benign	0.00
R7592:Gucy2e	UTSW	11	69223324	critical splice donor site	probably null
R7658:Gucy2e	UTSW	11	69226229	nonsense	probably null
R7812:Gucy2e	UTSW	11	69226243	missense	probably damaging	1.00
R8284:Gucy2e	UTSW	11	69232351	missense	probably benign
R8479:Gucy2e	UTSW	11	69232963	missense	probably benign	0.22
R8537:Gucy2e	UTSW	11	69236353	missense	probably benign	0.01
R8806:Gucy2e	UTSW	11	69236116	missense	probably benign
R9030:Gucy2e	UTSW	11	69225001	missense	probably damaging	1.00
R9192:Gucy2e	UTSW	11	69236477	missense	probably damaging	1.00
R9217:Gucy2e	UTSW	11	69235952	missense	possibly damaging	0.63
R9304:Gucy2e	UTSW	11	69235734	missense	probably benign	0.20
R9566:Gucy2e	UTSW	11	69228121	missense	probably damaging	1.00
X0025:Gucy2e	UTSW	11	69226244	missense	probably damaging	1.00
Z1186:Gucy2e	UTSW	11	69223605	missense	probably benign	0.00
Z1186:Gucy2e	UTSW	11	69236603	missense	unknown
Z1187:Gucy2e	UTSW	11	69223605	missense	probably benign	0.00
Z1187:Gucy2e	UTSW	11	69236603	missense	unknown
Z1188:Gucy2e	UTSW	11	69223605	missense	probably benign	0.00
Z1188:Gucy2e	UTSW	11	69236603	missense	unknown
Z1189:Gucy2e	UTSW	11	69223605	missense	probably benign	0.00
Z1189:Gucy2e	UTSW	11	69236603	missense	unknown
Z1190:Gucy2e	UTSW	11	69223605	missense	probably benign	0.00
Z1190:Gucy2e	UTSW	11	69236603	missense	unknown
Z1191:Gucy2e	UTSW	11	69223605	missense	probably benign	0.00
Z1191:Gucy2e	UTSW	11	69236603	missense	unknown
Z1192:Gucy2e	UTSW	11	69223605	missense	probably benign	0.00
Z1192:Gucy2e	UTSW	11	69236603	missense	unknown

Predicted Primers

PCR Primer
(F):5'- GTCTGTTACACTCACGCAGTCCAG -3'
(R):5'- GCCCAAATGCAACTCCTGCTTC -3'

Sequencing Primer
(F):5'- TGAAGCTGGCCTTGCTC -3'
(R):5'- AGAATATCTGCCCTAGTCTAGCC -3'

Posted On

2013-05-23