Incidental Mutation 'R5297:Efemp1'
ID405496
Institutional Source Beutler Lab
Gene Symbol Efemp1
Ensembl Gene ENSMUSG00000020467
Gene Nameepidermal growth factor-containing fibulin-like extracellular matrix protein 1
Synonyms
MMRRC Submission 042880-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5297 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location28853204-28926743 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 28867868 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Cysteine at position 116 (G116C)
Ref Sequence ENSEMBL: ENSMUSP00000020759 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020759]
Predicted Effect probably damaging
Transcript: ENSMUST00000020759
AA Change: G116C

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000020759
Gene: ENSMUSG00000020467
AA Change: G116C

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
EGF_like 44 76 9.53e-2 SMART
low complexity region 87 104 N/A INTRINSIC
EGF_CA 173 213 5.78e-11 SMART
EGF_CA 214 253 2.35e-11 SMART
EGF_CA 254 293 1.22e-9 SMART
EGF_CA 294 333 1.35e-11 SMART
EGF_like 334 378 3.49e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124103
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the fibulin family of extracellular matrix glycoproteins. Like all members of this family, the encoded protein contains tandemly repeated epidermal growth factor-like repeats followed by a C-terminus fibulin-type domain. This gene is upregulated in malignant gliomas and may play a role in the aggressive nature of these tumors. Mutations in this gene are associated with Doyne honeycomb retinal dystrophy. Alternatively spliced transcript variants that encode the same protein have been described.[provided by RefSeq, Nov 2009]
PHENOTYPE: Mice homozygous for disruptions in this gene display a normal phenotype. Mice homozygous for a single amino acid substitution develop deposits below the retinal pigment epithelium. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acbd6 G T 1: 155,587,458 A135S probably benign Het
Agbl4 A G 4: 111,566,698 K307R possibly damaging Het
AI481877 A G 4: 59,047,543 W1359R probably benign Het
Akna T C 4: 63,381,846 E653G possibly damaging Het
Arhgap26 T C 18: 39,121,888 Y273H probably damaging Het
Atg14 G A 14: 47,568,199 R70C probably damaging Het
Atp1a1 C T 3: 101,591,127 V250M possibly damaging Het
Cacna1c T G 6: 118,742,361 D215A probably damaging Het
Cadps T A 14: 12,822,345 N132Y probably damaging Het
Casp6 T C 3: 129,910,555 F97L possibly damaging Het
Ckap2l T C 2: 129,285,370 N296S possibly damaging Het
Col6a4 T C 9: 106,074,867 K611E probably benign Het
Copa A G 1: 172,113,108 H696R probably damaging Het
Cyp2a4 T A 7: 26,312,204 N283K probably benign Het
Dcc C T 18: 71,378,738 V869I probably benign Het
F830045P16Rik T C 2: 129,460,553 E373G probably benign Het
Fbxo9 T C 9: 78,086,279 T318A probably benign Het
Gipr A G 7: 19,157,544 W403R probably damaging Het
Gm10093 A G 17: 78,492,758 S393G probably benign Het
Gm12794 T A 4: 101,941,151 D106E possibly damaging Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Golgb1 G A 16: 36,875,616 probably benign Het
Herc3 T C 6: 58,856,641 L171P probably damaging Het
Il5ra A G 6: 106,738,134 I221T probably benign Het
Itgb2 A G 10: 77,564,667 I705V probably damaging Het
Map4k4 G T 1: 39,962,217 V55F probably damaging Het
Mast1 A G 8: 84,913,318 probably null Het
Mitf G T 6: 97,994,430 G186V probably benign Het
Mtpn C T 6: 35,512,290 D100N probably benign Het
Nrcam T C 12: 44,544,784 F204L probably damaging Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr1111 T C 2: 87,150,449 I71V probably benign Het
Olfr1510 A G 14: 52,410,218 L218P probably damaging Het
Olfr248 A G 1: 174,391,200 M44V probably benign Het
Olfr381 A T 11: 73,486,389 V145E probably damaging Het
Olfr446 T C 6: 42,927,437 S69P probably benign Het
Olfr503 A T 7: 108,545,404 N291I probably damaging Het
Pclo A T 5: 14,676,249 probably benign Het
Pik3ca T A 3: 32,450,053 Y631N probably damaging Het
Ptk2b T C 14: 66,172,517 D462G probably benign Het
Rnf19a A G 15: 36,247,778 S427P probably damaging Het
Scn3a T A 2: 65,469,034 Y1376F possibly damaging Het
Spem1 A G 11: 69,820,927 Y304H probably damaging Het
Stk38l C A 6: 146,775,655 Y450* probably null Het
Stx19 A G 16: 62,821,974 E51G probably damaging Het
Ttc41 C G 10: 86,776,579 Q1239E probably benign Het
Tuba3a C T 6: 125,281,340 R229H probably damaging Het
Utp18 A T 11: 93,876,089 V264D probably damaging Het
V1rd19 T C 7: 24,003,289 V60A probably damaging Het
Virma T G 4: 11,494,819 V40G probably damaging Het
Vmn1r160 C T 7: 22,871,290 Q23* probably null Het
Vmn2r13 T C 5: 109,191,939 I57V probably benign Het
Vmn2r26 T A 6: 124,061,873 F802L probably damaging Het
Vmn2r61 A G 7: 42,260,222 D57G probably benign Het
Vps13c A G 9: 67,878,131 N260S probably damaging Het
Xirp1 C A 9: 120,019,602 A72S probably damaging Het
Zfp212 T C 6: 47,929,077 V190A probably benign Het
Zfp703 C T 8: 26,979,205 P299L probably damaging Het
Other mutations in Efemp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00816:Efemp1 APN 11 28926223 missense probably benign 0.32
IGL01862:Efemp1 APN 11 28921428 missense probably damaging 0.97
IGL02568:Efemp1 APN 11 28916971 critical splice donor site probably null
IGL03175:Efemp1 APN 11 28926259 missense probably benign 0.04
IGL03014:Efemp1 UTSW 11 28926218 missense probably damaging 0.96
R0973:Efemp1 UTSW 11 28854538 missense probably damaging 1.00
R0973:Efemp1 UTSW 11 28854538 missense probably damaging 1.00
R0974:Efemp1 UTSW 11 28854538 missense probably damaging 1.00
R1678:Efemp1 UTSW 11 28916942 missense probably benign 0.00
R1701:Efemp1 UTSW 11 28921750 missense possibly damaging 0.68
R1831:Efemp1 UTSW 11 28921442 missense possibly damaging 0.91
R2016:Efemp1 UTSW 11 28921613 missense probably damaging 1.00
R2017:Efemp1 UTSW 11 28921613 missense probably damaging 1.00
R2024:Efemp1 UTSW 11 28914696 missense possibly damaging 0.85
R2025:Efemp1 UTSW 11 28914696 missense possibly damaging 0.85
R2027:Efemp1 UTSW 11 28914696 missense possibly damaging 0.85
R2084:Efemp1 UTSW 11 28915763 missense probably damaging 1.00
R2396:Efemp1 UTSW 11 28867941 missense possibly damaging 0.83
R4803:Efemp1 UTSW 11 28921795 missense possibly damaging 0.84
R4817:Efemp1 UTSW 11 28926241 missense probably damaging 1.00
R5201:Efemp1 UTSW 11 28914590 missense probably benign 0.05
R5534:Efemp1 UTSW 11 28867758 missense probably damaging 1.00
R5839:Efemp1 UTSW 11 28921418 missense possibly damaging 0.95
R6037:Efemp1 UTSW 11 28921760 missense probably damaging 1.00
R6037:Efemp1 UTSW 11 28921760 missense probably damaging 1.00
R6314:Efemp1 UTSW 11 28914603 missense probably benign 0.12
R7067:Efemp1 UTSW 11 28867926 missense probably damaging 1.00
R7396:Efemp1 UTSW 11 28867501 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- ACATTGTCCCAGATGCTTGC -3'
(R):5'- CAGGAGGATCAATACAAGCCATGC -3'

Sequencing Primer
(F):5'- CATTGTCCCAGATGCTTGCAAAGG -3'
(R):5'- AAGCCATGCTCACCTTGG -3'
Posted On2016-07-22