Incidental Mutation 'R5297:Or1e22'
ID 405499
Institutional Source Beutler Lab
Gene Symbol Or1e22
Ensembl Gene ENSMUSG00000072708
Gene Name olfactory receptor family 1 subfamily E member 22
Synonyms Olfr381, GA_x6K02T2P1NL-3646409-3645474, MOR135-4
MMRRC Submission 042880-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.092) question?
Stock # R5297 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 73376713-73377648 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 73377215 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 145 (V145E)
Ref Sequence ENSEMBL: ENSMUSP00000149355 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078358] [ENSMUST00000119863] [ENSMUST00000214623] [ENSMUST00000215358]
AlphaFold Q5SSP0
Predicted Effect probably damaging
Transcript: ENSMUST00000078358
AA Change: V145E

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000077467
Gene: ENSMUSG00000072708
AA Change: V145E

DomainStartEndE-ValueType
Pfam:7tm_1 41 290 1.3e-35 PFAM
Pfam:7tm_4 139 283 5.3e-42 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000119863
AA Change: V145E

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000113846
Gene: ENSMUSG00000072708
AA Change: V145E

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 4.2e-57 PFAM
Pfam:7tm_1 41 290 2e-27 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206673
Predicted Effect probably damaging
Transcript: ENSMUST00000214623
AA Change: V145E

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000215358
AA Change: V145E

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acbd6 G T 1: 155,463,204 (GRCm39) A135S probably benign Het
Agbl4 A G 4: 111,423,895 (GRCm39) K307R possibly damaging Het
Akna T C 4: 63,300,083 (GRCm39) E653G possibly damaging Het
Arhgap26 T C 18: 39,254,941 (GRCm39) Y273H probably damaging Het
Atg14 G A 14: 47,805,656 (GRCm39) R70C probably damaging Het
Atp1a1 C T 3: 101,498,443 (GRCm39) V250M possibly damaging Het
Cacna1c T G 6: 118,719,322 (GRCm39) D215A probably damaging Het
Cadps T A 14: 12,822,345 (GRCm38) N132Y probably damaging Het
Casp6 T C 3: 129,704,204 (GRCm39) F97L possibly damaging Het
Ckap2l T C 2: 129,127,290 (GRCm39) N296S possibly damaging Het
Col6a4 T C 9: 105,952,066 (GRCm39) K611E probably benign Het
Copa A G 1: 171,940,675 (GRCm39) H696R probably damaging Het
Cyp2a4 T A 7: 26,011,629 (GRCm39) N283K probably benign Het
Dcc C T 18: 71,511,809 (GRCm39) V869I probably benign Het
Efemp1 G T 11: 28,817,868 (GRCm39) G116C probably damaging Het
F830045P16Rik T C 2: 129,302,473 (GRCm39) E373G probably benign Het
Fbxo9 T C 9: 77,993,561 (GRCm39) T318A probably benign Het
Gipr A G 7: 18,891,469 (GRCm39) W403R probably damaging Het
Gm4787 G C 12: 81,424,604 (GRCm39) T518S probably benign Het
Golgb1 G A 16: 36,695,978 (GRCm39) probably benign Het
Hdac1-ps A G 17: 78,800,187 (GRCm39) S393G probably benign Het
Herc3 T C 6: 58,833,626 (GRCm39) L171P probably damaging Het
Il5ra A G 6: 106,715,095 (GRCm39) I221T probably benign Het
Itgb2 A G 10: 77,400,501 (GRCm39) I705V probably damaging Het
Map4k4 G T 1: 40,001,377 (GRCm39) V55F probably damaging Het
Mast1 A G 8: 85,639,947 (GRCm39) probably null Het
Mitf G T 6: 97,971,391 (GRCm39) G186V probably benign Het
Mtpn C T 6: 35,489,225 (GRCm39) D100N probably benign Het
Nrcam T C 12: 44,591,567 (GRCm39) F204L probably damaging Het
Or10g1 A G 14: 52,647,675 (GRCm39) L218P probably damaging Het
Or10x4 A G 1: 174,218,766 (GRCm39) M44V probably benign Het
Or1e16 AGCGGTCGTAGGC AGC 11: 73,286,480 (GRCm39) probably null Het
Or2a12 T C 6: 42,904,371 (GRCm39) S69P probably benign Het
Or52n4b A T 7: 108,144,611 (GRCm39) N291I probably damaging Het
Or5as1 T C 2: 86,980,793 (GRCm39) I71V probably benign Het
Pclo A T 5: 14,726,263 (GRCm39) probably benign Het
Pik3ca T A 3: 32,504,202 (GRCm39) Y631N probably damaging Het
Pramel19 T A 4: 101,798,348 (GRCm39) D106E possibly damaging Het
Ptk2b T C 14: 66,409,966 (GRCm39) D462G probably benign Het
Rnf19a A G 15: 36,247,924 (GRCm39) S427P probably damaging Het
Scn3a T A 2: 65,299,378 (GRCm39) Y1376F possibly damaging Het
Shoc1 A G 4: 59,047,543 (GRCm39) W1359R probably benign Het
Spem1 A G 11: 69,711,753 (GRCm39) Y304H probably damaging Het
Stk38l C A 6: 146,677,153 (GRCm39) Y450* probably null Het
Stx19 A G 16: 62,642,337 (GRCm39) E51G probably damaging Het
Ttc41 C G 10: 86,612,443 (GRCm39) Q1239E probably benign Het
Tuba3a C T 6: 125,258,303 (GRCm39) R229H probably damaging Het
Utp18 A T 11: 93,766,915 (GRCm39) V264D probably damaging Het
V1rd19 T C 7: 23,702,714 (GRCm39) V60A probably damaging Het
Virma T G 4: 11,494,819 (GRCm39) V40G probably damaging Het
Vmn1r160 C T 7: 22,570,715 (GRCm39) Q23* probably null Het
Vmn2r13 T C 5: 109,339,805 (GRCm39) I57V probably benign Het
Vmn2r26 T A 6: 124,038,832 (GRCm39) F802L probably damaging Het
Vmn2r61 A G 7: 41,909,646 (GRCm39) D57G probably benign Het
Vps13c A G 9: 67,785,413 (GRCm39) N260S probably damaging Het
Xirp1 C A 9: 119,848,668 (GRCm39) A72S probably damaging Het
Zfp212 T C 6: 47,906,011 (GRCm39) V190A probably benign Het
Zfp703 C T 8: 27,469,233 (GRCm39) P299L probably damaging Het
Other mutations in Or1e22
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00156:Or1e22 APN 11 73,377,398 (GRCm39) missense probably benign 0.22
IGL02867:Or1e22 APN 11 73,376,817 (GRCm39) missense probably damaging 1.00
IGL03202:Or1e22 APN 11 73,377,351 (GRCm39) nonsense probably null
R0207:Or1e22 UTSW 11 73,377,401 (GRCm39) missense probably benign 0.00
R0539:Or1e22 UTSW 11 73,376,889 (GRCm39) missense probably benign 0.22
R1469:Or1e22 UTSW 11 73,377,149 (GRCm39) missense possibly damaging 0.81
R1469:Or1e22 UTSW 11 73,377,149 (GRCm39) missense possibly damaging 0.81
R1835:Or1e22 UTSW 11 73,377,200 (GRCm39) missense probably benign 0.08
R2095:Or1e22 UTSW 11 73,377,420 (GRCm39) missense probably damaging 1.00
R3612:Or1e22 UTSW 11 73,376,766 (GRCm39) missense probably benign 0.23
R3983:Or1e22 UTSW 11 73,376,961 (GRCm39) missense possibly damaging 0.84
R4959:Or1e22 UTSW 11 73,376,893 (GRCm39) nonsense probably null
R4983:Or1e22 UTSW 11 73,377,623 (GRCm39) missense probably benign 0.04
R5447:Or1e22 UTSW 11 73,377,002 (GRCm39) missense probably benign 0.01
R5569:Or1e22 UTSW 11 73,377,518 (GRCm39) missense probably damaging 0.97
R5580:Or1e22 UTSW 11 73,377,036 (GRCm39) missense probably benign
R5711:Or1e22 UTSW 11 73,377,008 (GRCm39) missense probably damaging 1.00
R5810:Or1e22 UTSW 11 73,376,921 (GRCm39) nonsense probably null
R6974:Or1e22 UTSW 11 73,377,299 (GRCm39) missense probably benign 0.00
R7383:Or1e22 UTSW 11 73,376,715 (GRCm39) makesense probably null
R7661:Or1e22 UTSW 11 73,377,426 (GRCm39) missense probably damaging 1.00
R7748:Or1e22 UTSW 11 73,376,994 (GRCm39) missense probably benign 0.03
R7913:Or1e22 UTSW 11 73,377,224 (GRCm39) missense probably benign 0.01
R9400:Or1e22 UTSW 11 73,376,807 (GRCm39) missense probably damaging 1.00
R9666:Or1e22 UTSW 11 73,376,885 (GRCm39) missense probably damaging 0.98
Z1177:Or1e22 UTSW 11 73,376,979 (GRCm39) missense probably benign 0.36
Predicted Primers PCR Primer
(F):5'- ATGGCCCGAGTAGATGAAATC -3'
(R):5'- ATGCAGAGCCAGGACACATC -3'

Sequencing Primer
(F):5'- TGGCCCGAGTAGATGAAATCTTTAG -3'
(R):5'- ACATCCATCCCCTATGCAGGTTG -3'
Posted On 2016-07-22