Incidental Mutation 'R5297:Cadps'
ID 405504
Institutional Source Beutler Lab
Gene Symbol Cadps
Ensembl Gene ENSMUSG00000054423
Gene Name Ca2+-dependent secretion activator
Synonyms CAPS1
MMRRC Submission 042880-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5297 (G1)
Quality Score 141
Status Not validated
Chromosome 14
Chromosomal Location 9646684-10097200 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 12822345 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Tyrosine at position 132 (N132Y)
Ref Sequence ENSEMBL: ENSMUSP00000136076 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067491] [ENSMUST00000112657] [ENSMUST00000112658] [ENSMUST00000177814] [ENSMUST00000224882]
AlphaFold Q80TJ1
Predicted Effect probably damaging
Transcript: ENSMUST00000067491
AA Change: N132Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000064706
Gene: ENSMUSG00000054423
AA Change: N132Y

DomainStartEndE-ValueType
low complexity region 5 18 N/A INTRINSIC
low complexity region 41 75 N/A INTRINSIC
coiled coil region 93 121 N/A INTRINSIC
C2 397 492 1.08e-2 SMART
PH 520 624 1.78e-10 SMART
low complexity region 772 783 N/A INTRINSIC
DUF1041 833 948 6.21e-54 SMART
low complexity region 1022 1045 N/A INTRINSIC
low complexity region 1354 1361 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112657
AA Change: N132Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000108276
Gene: ENSMUSG00000054423
AA Change: N132Y

DomainStartEndE-ValueType
low complexity region 5 18 N/A INTRINSIC
low complexity region 41 75 N/A INTRINSIC
coiled coil region 93 121 N/A INTRINSIC
C2 397 492 1.08e-2 SMART
PH 520 624 1.78e-10 SMART
low complexity region 775 786 N/A INTRINSIC
DUF1041 836 941 3.88e-55 SMART
low complexity region 1015 1038 N/A INTRINSIC
low complexity region 1347 1354 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112658
AA Change: N132Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000108277
Gene: ENSMUSG00000054423
AA Change: N132Y

DomainStartEndE-ValueType
low complexity region 5 18 N/A INTRINSIC
low complexity region 41 75 N/A INTRINSIC
coiled coil region 93 121 N/A INTRINSIC
C2 397 492 1.08e-2 SMART
PH 520 624 1.78e-10 SMART
low complexity region 776 787 N/A INTRINSIC
DUF1041 837 942 3.88e-55 SMART
low complexity region 1016 1039 N/A INTRINSIC
low complexity region 1348 1355 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000177814
AA Change: N132Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000136076
Gene: ENSMUSG00000054423
AA Change: N132Y

DomainStartEndE-ValueType
low complexity region 5 18 N/A INTRINSIC
low complexity region 41 75 N/A INTRINSIC
coiled coil region 93 121 N/A INTRINSIC
C2 397 492 1.08e-2 SMART
PH 520 624 1.78e-10 SMART
low complexity region 777 788 N/A INTRINSIC
DUF1041 838 943 2.75e-55 SMART
low complexity region 1017 1040 N/A INTRINSIC
low complexity region 1349 1356 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000224882
AA Change: N132Y

PolyPhen 2 Score 0.836 (Sensitivity: 0.84; Specificity: 0.93)
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a novel neural/endocrine-specific cytosolic and peripheral membrane protein required for the Ca2+-regulated exocytosis of secretory vesicles. The protein acts at a stage in exocytosis that follows ATP-dependent priming, which involves the essential synthesis of phosphatidylinositol 4,5-bisphosphate (PtdIns(4,5)P2). Alternative splicing has been observed at this locus and three variants, encoding distinct isoforms, are described. [provided by RefSeq, Aug 2008]
PHENOTYPE: Homozygous null mice display neonatal lethality, respiratory failure and abnormal adrenal gland physiology. Adult heterozygous null mice display abnormal adrenal gland physiology that is different from that seen in homozygous neonates. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acbd6 G T 1: 155,463,204 (GRCm39) A135S probably benign Het
Agbl4 A G 4: 111,423,895 (GRCm39) K307R possibly damaging Het
Akna T C 4: 63,300,083 (GRCm39) E653G possibly damaging Het
Arhgap26 T C 18: 39,254,941 (GRCm39) Y273H probably damaging Het
Atg14 G A 14: 47,805,656 (GRCm39) R70C probably damaging Het
Atp1a1 C T 3: 101,498,443 (GRCm39) V250M possibly damaging Het
Cacna1c T G 6: 118,719,322 (GRCm39) D215A probably damaging Het
Casp6 T C 3: 129,704,204 (GRCm39) F97L possibly damaging Het
Ckap2l T C 2: 129,127,290 (GRCm39) N296S possibly damaging Het
Col6a4 T C 9: 105,952,066 (GRCm39) K611E probably benign Het
Copa A G 1: 171,940,675 (GRCm39) H696R probably damaging Het
Cyp2a4 T A 7: 26,011,629 (GRCm39) N283K probably benign Het
Dcc C T 18: 71,511,809 (GRCm39) V869I probably benign Het
Efemp1 G T 11: 28,817,868 (GRCm39) G116C probably damaging Het
F830045P16Rik T C 2: 129,302,473 (GRCm39) E373G probably benign Het
Fbxo9 T C 9: 77,993,561 (GRCm39) T318A probably benign Het
Gipr A G 7: 18,891,469 (GRCm39) W403R probably damaging Het
Gm4787 G C 12: 81,424,604 (GRCm39) T518S probably benign Het
Golgb1 G A 16: 36,695,978 (GRCm39) probably benign Het
Hdac1-ps A G 17: 78,800,187 (GRCm39) S393G probably benign Het
Herc3 T C 6: 58,833,626 (GRCm39) L171P probably damaging Het
Il5ra A G 6: 106,715,095 (GRCm39) I221T probably benign Het
Itgb2 A G 10: 77,400,501 (GRCm39) I705V probably damaging Het
Map4k4 G T 1: 40,001,377 (GRCm39) V55F probably damaging Het
Mast1 A G 8: 85,639,947 (GRCm39) probably null Het
Mitf G T 6: 97,971,391 (GRCm39) G186V probably benign Het
Mtpn C T 6: 35,489,225 (GRCm39) D100N probably benign Het
Nrcam T C 12: 44,591,567 (GRCm39) F204L probably damaging Het
Or10g1 A G 14: 52,647,675 (GRCm39) L218P probably damaging Het
Or10x4 A G 1: 174,218,766 (GRCm39) M44V probably benign Het
Or1e16 AGCGGTCGTAGGC AGC 11: 73,286,480 (GRCm39) probably null Het
Or1e22 A T 11: 73,377,215 (GRCm39) V145E probably damaging Het
Or2a12 T C 6: 42,904,371 (GRCm39) S69P probably benign Het
Or52n4b A T 7: 108,144,611 (GRCm39) N291I probably damaging Het
Or5as1 T C 2: 86,980,793 (GRCm39) I71V probably benign Het
Pclo A T 5: 14,726,263 (GRCm39) probably benign Het
Pik3ca T A 3: 32,504,202 (GRCm39) Y631N probably damaging Het
Pramel19 T A 4: 101,798,348 (GRCm39) D106E possibly damaging Het
Ptk2b T C 14: 66,409,966 (GRCm39) D462G probably benign Het
Rnf19a A G 15: 36,247,924 (GRCm39) S427P probably damaging Het
Scn3a T A 2: 65,299,378 (GRCm39) Y1376F possibly damaging Het
Shoc1 A G 4: 59,047,543 (GRCm39) W1359R probably benign Het
Spem1 A G 11: 69,711,753 (GRCm39) Y304H probably damaging Het
Stk38l C A 6: 146,677,153 (GRCm39) Y450* probably null Het
Stx19 A G 16: 62,642,337 (GRCm39) E51G probably damaging Het
Ttc41 C G 10: 86,612,443 (GRCm39) Q1239E probably benign Het
Tuba3a C T 6: 125,258,303 (GRCm39) R229H probably damaging Het
Utp18 A T 11: 93,766,915 (GRCm39) V264D probably damaging Het
V1rd19 T C 7: 23,702,714 (GRCm39) V60A probably damaging Het
Virma T G 4: 11,494,819 (GRCm39) V40G probably damaging Het
Vmn1r160 C T 7: 22,570,715 (GRCm39) Q23* probably null Het
Vmn2r13 T C 5: 109,339,805 (GRCm39) I57V probably benign Het
Vmn2r26 T A 6: 124,038,832 (GRCm39) F802L probably damaging Het
Vmn2r61 A G 7: 41,909,646 (GRCm39) D57G probably benign Het
Vps13c A G 9: 67,785,413 (GRCm39) N260S probably damaging Het
Xirp1 C A 9: 119,848,668 (GRCm39) A72S probably damaging Het
Zfp212 T C 6: 47,906,011 (GRCm39) V190A probably benign Het
Zfp703 C T 8: 27,469,233 (GRCm39) P299L probably damaging Het
Other mutations in Cadps
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00926:Cadps APN 14 12,491,795 (GRCm38) missense probably damaging 1.00
IGL00990:Cadps APN 14 12,715,374 (GRCm38) missense possibly damaging 0.56
IGL01071:Cadps APN 14 12,509,091 (GRCm38) splice site probably null
IGL01339:Cadps APN 14 12,486,543 (GRCm38) missense possibly damaging 0.58
IGL01518:Cadps APN 14 12,522,352 (GRCm38) missense probably damaging 1.00
IGL01560:Cadps APN 14 12,491,792 (GRCm38) missense probably damaging 1.00
IGL01598:Cadps APN 14 12,522,202 (GRCm38) critical splice donor site probably null
IGL01603:Cadps APN 14 12,454,154 (GRCm38) splice site probably benign
IGL01836:Cadps APN 14 12,522,311 (GRCm38) missense probably damaging 1.00
IGL01839:Cadps APN 14 12,467,184 (GRCm38) splice site probably benign
IGL01932:Cadps APN 14 12,373,609 (GRCm38) utr 3 prime probably benign
IGL02172:Cadps APN 14 12,705,681 (GRCm38) missense probably damaging 1.00
IGL02175:Cadps APN 14 12,467,092 (GRCm38) missense probably damaging 0.96
IGL02212:Cadps APN 14 12,522,345 (GRCm38) missense possibly damaging 0.94
IGL02351:Cadps APN 14 12,597,380 (GRCm38) missense probably damaging 0.99
IGL02358:Cadps APN 14 12,597,380 (GRCm38) missense probably damaging 0.99
IGL02499:Cadps APN 14 12,822,725 (GRCm38) nonsense probably null
IGL02505:Cadps APN 14 12,449,759 (GRCm38) missense probably damaging 1.00
IGL02591:Cadps APN 14 12,473,465 (GRCm38) missense probably damaging 1.00
IGL02592:Cadps APN 14 12,473,465 (GRCm38) missense probably damaging 1.00
IGL02671:Cadps APN 14 12,491,824 (GRCm38) missense probably damaging 1.00
IGL02956:Cadps APN 14 12,418,047 (GRCm38) splice site probably benign
IGL03029:Cadps APN 14 12,376,675 (GRCm38) missense probably damaging 1.00
IGL03216:Cadps APN 14 12,439,944 (GRCm38) missense probably damaging 1.00
IGL03282:Cadps APN 14 12,465,856 (GRCm38) splice site probably benign
turbo UTSW 14 12,491,800 (GRCm38) missense probably damaging 1.00
R0241:Cadps UTSW 14 12,376,675 (GRCm38) missense probably damaging 1.00
R0241:Cadps UTSW 14 12,376,675 (GRCm38) missense probably damaging 1.00
R0420:Cadps UTSW 14 12,491,800 (GRCm38) missense probably damaging 1.00
R1180:Cadps UTSW 14 12,457,836 (GRCm38) splice site probably benign
R1398:Cadps UTSW 14 12,449,822 (GRCm38) missense probably damaging 1.00
R1678:Cadps UTSW 14 12,517,802 (GRCm38) critical splice donor site probably null
R1792:Cadps UTSW 14 12,449,802 (GRCm38) missense possibly damaging 0.93
R1863:Cadps UTSW 14 12,505,796 (GRCm38) missense probably benign 0.09
R1863:Cadps UTSW 14 12,449,802 (GRCm38) missense possibly damaging 0.93
R1918:Cadps UTSW 14 12,546,372 (GRCm38) missense probably damaging 0.99
R1920:Cadps UTSW 14 12,465,859 (GRCm38) missense possibly damaging 0.64
R1921:Cadps UTSW 14 12,465,859 (GRCm38) missense possibly damaging 0.64
R1922:Cadps UTSW 14 12,465,859 (GRCm38) missense possibly damaging 0.64
R1925:Cadps UTSW 14 12,705,726 (GRCm38) missense probably damaging 1.00
R1966:Cadps UTSW 14 12,822,450 (GRCm38) nonsense probably null
R2013:Cadps UTSW 14 12,522,337 (GRCm38) missense probably damaging 1.00
R2228:Cadps UTSW 14 12,465,935 (GRCm38) missense probably benign 0.05
R2331:Cadps UTSW 14 12,603,692 (GRCm38) missense probably damaging 1.00
R3436:Cadps UTSW 14 12,616,158 (GRCm38) splice site probably null
R3853:Cadps UTSW 14 12,509,090 (GRCm38) splice site probably benign
R3893:Cadps UTSW 14 12,488,883 (GRCm38) utr 3 prime probably benign
R3916:Cadps UTSW 14 12,457,702 (GRCm38) missense probably benign 0.00
R3917:Cadps UTSW 14 12,457,702 (GRCm38) missense probably benign 0.00
R3953:Cadps UTSW 14 12,505,937 (GRCm38) missense probably damaging 1.00
R3966:Cadps UTSW 14 12,522,161 (GRCm38) splice site probably null
R4024:Cadps UTSW 14 12,705,539 (GRCm38) missense probably damaging 1.00
R4079:Cadps UTSW 14 12,457,702 (GRCm38) missense probably benign 0.00
R4230:Cadps UTSW 14 12,488,987 (GRCm38) missense probably damaging 0.98
R4333:Cadps UTSW 14 12,467,031 (GRCm38) missense probably damaging 1.00
R4410:Cadps UTSW 14 12,822,323 (GRCm38) missense probably damaging 0.98
R4586:Cadps UTSW 14 12,505,808 (GRCm38) missense probably damaging 1.00
R4685:Cadps UTSW 14 12,467,139 (GRCm38) missense possibly damaging 0.77
R4698:Cadps UTSW 14 12,705,654 (GRCm38) missense possibly damaging 0.90
R4855:Cadps UTSW 14 12,822,449 (GRCm38) missense unknown
R4898:Cadps UTSW 14 12,411,588 (GRCm38) missense possibly damaging 0.86
R4908:Cadps UTSW 14 12,536,386 (GRCm38) missense probably damaging 1.00
R5208:Cadps UTSW 14 12,457,711 (GRCm38) missense possibly damaging 0.68
R5328:Cadps UTSW 14 12,457,790 (GRCm38) missense probably benign 0.31
R5408:Cadps UTSW 14 12,705,759 (GRCm38) missense possibly damaging 0.87
R5529:Cadps UTSW 14 12,454,285 (GRCm38) missense probably damaging 1.00
R5567:Cadps UTSW 14 12,473,497 (GRCm38) missense possibly damaging 0.49
R5570:Cadps UTSW 14 12,473,497 (GRCm38) missense possibly damaging 0.49
R5727:Cadps UTSW 14 12,486,525 (GRCm38) nonsense probably null
R5812:Cadps UTSW 14 12,376,685 (GRCm38) missense probably benign
R6361:Cadps UTSW 14 12,491,778 (GRCm38) nonsense probably null
R6767:Cadps UTSW 14 12,550,888 (GRCm38) missense probably damaging 1.00
R6805:Cadps UTSW 14 12,467,103 (GRCm38) missense probably damaging 0.99
R6861:Cadps UTSW 14 12,522,401 (GRCm38) nonsense probably null
R6883:Cadps UTSW 14 12,465,883 (GRCm38) missense probably damaging 0.96
R6887:Cadps UTSW 14 12,505,811 (GRCm38) missense probably damaging 1.00
R6997:Cadps UTSW 14 12,505,793 (GRCm38) missense possibly damaging 0.88
R7102:Cadps UTSW 14 12,603,738 (GRCm38) missense probably damaging 1.00
R7120:Cadps UTSW 14 12,439,919 (GRCm38) missense probably damaging 0.98
R7143:Cadps UTSW 14 12,491,838 (GRCm38) missense probably benign 0.02
R7290:Cadps UTSW 14 12,616,099 (GRCm38) missense probably damaging 1.00
R7614:Cadps UTSW 14 12,454,260 (GRCm38) missense probably damaging 1.00
R7674:Cadps UTSW 14 12,411,581 (GRCm38) missense probably damaging 0.99
R7715:Cadps UTSW 14 12,457,762 (GRCm38) missense probably benign 0.01
R7801:Cadps UTSW 14 12,489,476 (GRCm38) critical splice donor site probably null
R7814:Cadps UTSW 14 12,376,706 (GRCm38) missense probably damaging 0.99
R7915:Cadps UTSW 14 12,705,544 (GRCm38) missense possibly damaging 0.84
R8087:Cadps UTSW 14 12,536,380 (GRCm38) missense probably damaging 1.00
R8109:Cadps UTSW 14 12,488,975 (GRCm38) missense probably benign 0.00
R8485:Cadps UTSW 14 12,439,872 (GRCm38) missense probably damaging 1.00
R9156:Cadps UTSW 14 12,705,676 (GRCm38) missense probably damaging 1.00
R9158:Cadps UTSW 14 12,546,356 (GRCm38) missense probably benign 0.10
R9312:Cadps UTSW 14 12,616,095 (GRCm38) missense probably damaging 1.00
R9465:Cadps UTSW 14 12,489,002 (GRCm38) missense possibly damaging 0.93
R9519:Cadps UTSW 14 12,546,290 (GRCm38) missense possibly damaging 0.86
R9649:Cadps UTSW 14 12,597,418 (GRCm38) missense probably damaging 0.99
R9662:Cadps UTSW 14 12,411,567 (GRCm38) missense probably benign 0.02
R9674:Cadps UTSW 14 12,454,291 (GRCm38) missense probably damaging 1.00
X0018:Cadps UTSW 14 12,373,690 (GRCm38) missense probably damaging 1.00
X0028:Cadps UTSW 14 12,467,118 (GRCm38) missense possibly damaging 0.93
Z1088:Cadps UTSW 14 12,467,113 (GRCm38) missense probably damaging 0.96
Z1177:Cadps UTSW 14 12,465,880 (GRCm38) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACATCTCCCGAGTCAAGCTG -3'
(R):5'- TGACCTAGGAAGAAGCGCCTAC -3'

Sequencing Primer
(F):5'- AAGACGGGGCCCCTAATC -3'
(R):5'- TTTTGCACCCCAAGGCG -3'
Posted On 2016-07-22