Incidental Mutation 'R5297:Ptk2b'
ID405507
Institutional Source Beutler Lab
Gene Symbol Ptk2b
Ensembl Gene ENSMUSG00000059456
Gene NamePTK2 protein tyrosine kinase 2 beta
SynonymsCAKbeta, cellular adhesion kinase beta, E430023O05Rik, proline-rich tyrosine kinase 2, Raftk, related adhesion focal tyrosine kinase, PYK2, calcium-dependent tyrosine kinase
MMRRC Submission 042880-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.513) question?
Stock #R5297 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location66153257-66281052 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 66172517 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 462 (D462G)
Ref Sequence ENSEMBL: ENSMUSP00000137008 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022622] [ENSMUST00000089250] [ENSMUST00000111121] [ENSMUST00000178730]
Predicted Effect probably benign
Transcript: ENSMUST00000022622
AA Change: D462G

PolyPhen 2 Score 0.042 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000022622
Gene: ENSMUSG00000059456
AA Change: D462G

DomainStartEndE-ValueType
B41 35 265 1.33e-45 SMART
TyrKc 425 679 1.46e-139 SMART
low complexity region 713 726 N/A INTRINSIC
Pfam:Focal_AT 870 1008 1.7e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000089250
AA Change: D462G

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000086661
Gene: ENSMUSG00000059456
AA Change: D462G

DomainStartEndE-ValueType
B41 35 265 1.33e-45 SMART
TyrKc 425 679 1.46e-139 SMART
low complexity region 713 726 N/A INTRINSIC
Pfam:Focal_AT 828 966 2e-68 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111121
AA Change: D462G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000106750
Gene: ENSMUSG00000059456
AA Change: D462G

DomainStartEndE-ValueType
B41 35 265 1.33e-45 SMART
TyrKc 425 679 1.46e-139 SMART
low complexity region 713 726 N/A INTRINSIC
Pfam:Focal_AT 866 1004 1.1e-67 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127083
Predicted Effect probably benign
Transcript: ENSMUST00000154865
SMART Domains Protein: ENSMUSP00000122683
Gene: ENSMUSG00000059456

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 1 83 8.5e-27 PFAM
low complexity region 117 130 N/A INTRINSIC
Pfam:Focal_AT 243 375 5e-57 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000178730
AA Change: D462G

PolyPhen 2 Score 0.042 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000137008
Gene: ENSMUSG00000059456
AA Change: D462G

DomainStartEndE-ValueType
B41 35 265 1.33e-45 SMART
TyrKc 425 679 1.46e-139 SMART
low complexity region 713 726 N/A INTRINSIC
Pfam:Focal_AT 870 1002 2.1e-55 PFAM
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoplasmic protein tyrosine kinase which is involved in calcium-induced regulation of ion channels and activation of the map kinase signaling pathway. The encoded protein may represent an important signaling intermediate between neuropeptide-activated receptors or neurotransmitters that increase calcium flux and the downstream signals that regulate neuronal activity. The encoded protein undergoes rapid tyrosine phosphorylation and activation in response to increases in the intracellular calcium concentration, nicotinic acetylcholine receptor activation, membrane depolarization, or protein kinase C activation. This protein has been shown to bind CRK-associated substrate, nephrocystin, GTPase regulator associated with FAK, and the SH2 domain of GRB2. The encoded protein is a member of the FAK subfamily of protein tyrosine kinases but lacks significant sequence similarity to kinases from other subfamilies. Four transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele show alterations in endothelial nitric oxide synthase-mediated vascular function and angiogenic responses. Mice homozygous for a second knock-out allele exhibit multiple defects in macrophage migration and function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acbd6 G T 1: 155,587,458 A135S probably benign Het
Agbl4 A G 4: 111,566,698 K307R possibly damaging Het
AI481877 A G 4: 59,047,543 W1359R probably benign Het
Akna T C 4: 63,381,846 E653G possibly damaging Het
Arhgap26 T C 18: 39,121,888 Y273H probably damaging Het
Atg14 G A 14: 47,568,199 R70C probably damaging Het
Atp1a1 C T 3: 101,591,127 V250M possibly damaging Het
Cacna1c T G 6: 118,742,361 D215A probably damaging Het
Cadps T A 14: 12,822,345 N132Y probably damaging Het
Casp6 T C 3: 129,910,555 F97L possibly damaging Het
Ckap2l T C 2: 129,285,370 N296S possibly damaging Het
Col6a4 T C 9: 106,074,867 K611E probably benign Het
Copa A G 1: 172,113,108 H696R probably damaging Het
Cyp2a4 T A 7: 26,312,204 N283K probably benign Het
Dcc C T 18: 71,378,738 V869I probably benign Het
Efemp1 G T 11: 28,867,868 G116C probably damaging Het
F830045P16Rik T C 2: 129,460,553 E373G probably benign Het
Fbxo9 T C 9: 78,086,279 T318A probably benign Het
Gipr A G 7: 19,157,544 W403R probably damaging Het
Gm10093 A G 17: 78,492,758 S393G probably benign Het
Gm12794 T A 4: 101,941,151 D106E possibly damaging Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Golgb1 G A 16: 36,875,616 probably benign Het
Herc3 T C 6: 58,856,641 L171P probably damaging Het
Il5ra A G 6: 106,738,134 I221T probably benign Het
Itgb2 A G 10: 77,564,667 I705V probably damaging Het
Map4k4 G T 1: 39,962,217 V55F probably damaging Het
Mast1 A G 8: 84,913,318 probably null Het
Mitf G T 6: 97,994,430 G186V probably benign Het
Mtpn C T 6: 35,512,290 D100N probably benign Het
Nrcam T C 12: 44,544,784 F204L probably damaging Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr1111 T C 2: 87,150,449 I71V probably benign Het
Olfr1510 A G 14: 52,410,218 L218P probably damaging Het
Olfr248 A G 1: 174,391,200 M44V probably benign Het
Olfr381 A T 11: 73,486,389 V145E probably damaging Het
Olfr446 T C 6: 42,927,437 S69P probably benign Het
Olfr503 A T 7: 108,545,404 N291I probably damaging Het
Pclo A T 5: 14,676,249 probably benign Het
Pik3ca T A 3: 32,450,053 Y631N probably damaging Het
Rnf19a A G 15: 36,247,778 S427P probably damaging Het
Scn3a T A 2: 65,469,034 Y1376F possibly damaging Het
Spem1 A G 11: 69,820,927 Y304H probably damaging Het
Stk38l C A 6: 146,775,655 Y450* probably null Het
Stx19 A G 16: 62,821,974 E51G probably damaging Het
Ttc41 C G 10: 86,776,579 Q1239E probably benign Het
Tuba3a C T 6: 125,281,340 R229H probably damaging Het
Utp18 A T 11: 93,876,089 V264D probably damaging Het
V1rd19 T C 7: 24,003,289 V60A probably damaging Het
Virma T G 4: 11,494,819 V40G probably damaging Het
Vmn1r160 C T 7: 22,871,290 Q23* probably null Het
Vmn2r13 T C 5: 109,191,939 I57V probably benign Het
Vmn2r26 T A 6: 124,061,873 F802L probably damaging Het
Vmn2r61 A G 7: 42,260,222 D57G probably benign Het
Vps13c A G 9: 67,878,131 N260S probably damaging Het
Xirp1 C A 9: 120,019,602 A72S probably damaging Het
Zfp212 T C 6: 47,929,077 V190A probably benign Het
Zfp703 C T 8: 26,979,205 P299L probably damaging Het
Other mutations in Ptk2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01346:Ptk2b APN 14 66177118 missense possibly damaging 0.54
IGL01940:Ptk2b APN 14 66158613 missense probably benign 0.00
IGL02121:Ptk2b APN 14 66213482 missense probably benign 0.12
IGL02505:Ptk2b APN 14 66154243 missense probably damaging 1.00
IGL03036:Ptk2b APN 14 66173895 splice site probably benign
IGL03343:Ptk2b APN 14 66169421 missense probably benign 0.10
FR4548:Ptk2b UTSW 14 66173849 missense possibly damaging 0.95
FR4737:Ptk2b UTSW 14 66173849 missense possibly damaging 0.95
R0217:Ptk2b UTSW 14 66156381 missense probably damaging 1.00
R0478:Ptk2b UTSW 14 66213372 missense probably damaging 1.00
R0556:Ptk2b UTSW 14 66172144 missense probably damaging 1.00
R0631:Ptk2b UTSW 14 66177751 missense probably damaging 0.96
R0946:Ptk2b UTSW 14 66158598 missense probably benign 0.02
R1502:Ptk2b UTSW 14 66163080 missense possibly damaging 0.95
R1583:Ptk2b UTSW 14 66163114 missense possibly damaging 0.75
R1876:Ptk2b UTSW 14 66158392 missense probably benign 0.01
R1905:Ptk2b UTSW 14 66158670 missense probably damaging 1.00
R1942:Ptk2b UTSW 14 66169381 missense probably damaging 1.00
R2048:Ptk2b UTSW 14 66172505 missense probably benign 0.28
R2377:Ptk2b UTSW 14 66172548 missense possibly damaging 0.56
R3021:Ptk2b UTSW 14 66178183 splice site probably null
R3793:Ptk2b UTSW 14 66170251 missense probably damaging 1.00
R3836:Ptk2b UTSW 14 66156342 missense probably damaging 1.00
R3911:Ptk2b UTSW 14 66157068 missense possibly damaging 0.83
R4654:Ptk2b UTSW 14 66163047 missense possibly damaging 0.86
R4690:Ptk2b UTSW 14 66173300 splice site probably null
R4691:Ptk2b UTSW 14 66157069 missense probably benign 0.16
R4692:Ptk2b UTSW 14 66157069 missense probably benign 0.16
R4693:Ptk2b UTSW 14 66157069 missense probably benign 0.16
R4847:Ptk2b UTSW 14 66173882 missense probably damaging 1.00
R5176:Ptk2b UTSW 14 66156415 missense probably damaging 1.00
R5603:Ptk2b UTSW 14 66172065 nonsense probably null
R5935:Ptk2b UTSW 14 66173879 missense probably damaging 1.00
R6245:Ptk2b UTSW 14 66163066 missense probably damaging 1.00
R6313:Ptk2b UTSW 14 66178831 missense probably damaging 1.00
R6476:Ptk2b UTSW 14 66187474 missense possibly damaging 0.81
R6858:Ptk2b UTSW 14 66213398 missense probably damaging 1.00
R7235:Ptk2b UTSW 14 66157087 nonsense probably null
R7511:Ptk2b UTSW 14 66154244 missense possibly damaging 0.81
R7558:Ptk2b UTSW 14 66154179 missense possibly damaging 0.83
R7838:Ptk2b UTSW 14 66158401 missense probably benign
R7921:Ptk2b UTSW 14 66158401 missense probably benign
X0054:Ptk2b UTSW 14 66213328 missense probably benign 0.15
Y5405:Ptk2b UTSW 14 66154094 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGACAAGAGACCTTTTGCAATC -3'
(R):5'- TATGTGGTTAGGCTGCCAGC -3'

Sequencing Primer
(F):5'- ACCTTTTGCAATCAAGAGTGGG -3'
(R):5'- AGCATTGTGGTCCCTGAA -3'
Posted On2016-07-22