Incidental Mutation 'R5297:Rnf19a'
ID 405508
Institutional Source Beutler Lab
Gene Symbol Rnf19a
Ensembl Gene ENSMUSG00000022280
Gene Name ring finger protein 19A
Synonyms XY body protein, Dorfin, Rnf19, XYbp
MMRRC Submission 042880-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.493) question?
Stock # R5297 (G1)
Quality Score 225
Status Not validated
Chromosome 15
Chromosomal Location 36239933-36283147 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 36247778 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 427 (S427P)
Ref Sequence ENSEMBL: ENSMUSP00000022890 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022890] [ENSMUST00000228358]
AlphaFold P50636
Predicted Effect probably damaging
Transcript: ENSMUST00000022890
AA Change: S427P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022890
Gene: ENSMUSG00000022280
AA Change: S427P

DomainStartEndE-ValueType
low complexity region 40 56 N/A INTRINSIC
low complexity region 72 82 N/A INTRINSIC
RING 132 179 5.56e-3 SMART
IBR 199 264 1.5e-24 SMART
IBR 283 347 1.87e-2 SMART
transmembrane domain 373 395 N/A INTRINSIC
transmembrane domain 416 438 N/A INTRINSIC
low complexity region 502 520 N/A INTRINSIC
low complexity region 664 682 N/A INTRINSIC
low complexity region 723 734 N/A INTRINSIC
low complexity region 775 787 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000228358
AA Change: S427P

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ring between ring fingers (RBR) protein family, and the encoded protein contains two RING-finger motifs and an in between RING fingers motif. This protein is an E3 ubiquitin ligase that is localized to Lewy bodies, and ubiquitylates synphilin-1, which is an interacting protein of alpha synuclein in neurons. The encoded protein may be involved in amyotrophic lateral sclerosis and Parkinson's disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acbd6 G T 1: 155,587,458 A135S probably benign Het
Agbl4 A G 4: 111,566,698 K307R possibly damaging Het
AI481877 A G 4: 59,047,543 W1359R probably benign Het
Akna T C 4: 63,381,846 E653G possibly damaging Het
Arhgap26 T C 18: 39,121,888 Y273H probably damaging Het
Atg14 G A 14: 47,568,199 R70C probably damaging Het
Atp1a1 C T 3: 101,591,127 V250M possibly damaging Het
Cacna1c T G 6: 118,742,361 D215A probably damaging Het
Cadps T A 14: 12,822,345 N132Y probably damaging Het
Casp6 T C 3: 129,910,555 F97L possibly damaging Het
Ckap2l T C 2: 129,285,370 N296S possibly damaging Het
Col6a4 T C 9: 106,074,867 K611E probably benign Het
Copa A G 1: 172,113,108 H696R probably damaging Het
Cyp2a4 T A 7: 26,312,204 N283K probably benign Het
Dcc C T 18: 71,378,738 V869I probably benign Het
Efemp1 G T 11: 28,867,868 G116C probably damaging Het
F830045P16Rik T C 2: 129,460,553 E373G probably benign Het
Fbxo9 T C 9: 78,086,279 T318A probably benign Het
Gipr A G 7: 19,157,544 W403R probably damaging Het
Gm10093 A G 17: 78,492,758 S393G probably benign Het
Gm12794 T A 4: 101,941,151 D106E possibly damaging Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Golgb1 G A 16: 36,875,616 probably benign Het
Herc3 T C 6: 58,856,641 L171P probably damaging Het
Il5ra A G 6: 106,738,134 I221T probably benign Het
Itgb2 A G 10: 77,564,667 I705V probably damaging Het
Map4k4 G T 1: 39,962,217 V55F probably damaging Het
Mast1 A G 8: 84,913,318 probably null Het
Mitf G T 6: 97,994,430 G186V probably benign Het
Mtpn C T 6: 35,512,290 D100N probably benign Het
Nrcam T C 12: 44,544,784 F204L probably damaging Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr1111 T C 2: 87,150,449 I71V probably benign Het
Olfr1510 A G 14: 52,410,218 L218P probably damaging Het
Olfr248 A G 1: 174,391,200 M44V probably benign Het
Olfr381 A T 11: 73,486,389 V145E probably damaging Het
Olfr446 T C 6: 42,927,437 S69P probably benign Het
Olfr503 A T 7: 108,545,404 N291I probably damaging Het
Pclo A T 5: 14,676,249 probably benign Het
Pik3ca T A 3: 32,450,053 Y631N probably damaging Het
Ptk2b T C 14: 66,172,517 D462G probably benign Het
Scn3a T A 2: 65,469,034 Y1376F possibly damaging Het
Spem1 A G 11: 69,820,927 Y304H probably damaging Het
Stk38l C A 6: 146,775,655 Y450* probably null Het
Stx19 A G 16: 62,821,974 E51G probably damaging Het
Ttc41 C G 10: 86,776,579 Q1239E probably benign Het
Tuba3a C T 6: 125,281,340 R229H probably damaging Het
Utp18 A T 11: 93,876,089 V264D probably damaging Het
V1rd19 T C 7: 24,003,289 V60A probably damaging Het
Virma T G 4: 11,494,819 V40G probably damaging Het
Vmn1r160 C T 7: 22,871,290 Q23* probably null Het
Vmn2r13 T C 5: 109,191,939 I57V probably benign Het
Vmn2r26 T A 6: 124,061,873 F802L probably damaging Het
Vmn2r61 A G 7: 42,260,222 D57G probably benign Het
Vps13c A G 9: 67,878,131 N260S probably damaging Het
Xirp1 C A 9: 120,019,602 A72S probably damaging Het
Zfp212 T C 6: 47,929,077 V190A probably benign Het
Zfp703 C T 8: 26,979,205 P299L probably damaging Het
Other mutations in Rnf19a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Rnf19a APN 15 36265802 missense probably damaging 0.98
Cycle UTSW 15 36253304 intron probably benign
Tolkien UTSW 15 36265306 missense possibly damaging 0.80
Wagner UTSW 15 36244196 missense probably benign 0.05
R0245:Rnf19a UTSW 15 36253032 missense probably damaging 1.00
R0583:Rnf19a UTSW 15 36253005 missense probably damaging 1.00
R1295:Rnf19a UTSW 15 36244101 nonsense probably null
R1528:Rnf19a UTSW 15 36265655 missense possibly damaging 0.75
R1710:Rnf19a UTSW 15 36244207 missense probably damaging 1.00
R1835:Rnf19a UTSW 15 36265925 missense probably benign
R2005:Rnf19a UTSW 15 36241770 missense possibly damaging 0.52
R2110:Rnf19a UTSW 15 36254519 missense possibly damaging 0.79
R3118:Rnf19a UTSW 15 36241899 nonsense probably null
R3776:Rnf19a UTSW 15 36265912 missense probably benign 0.03
R4005:Rnf19a UTSW 15 36245628 missense probably damaging 0.98
R5184:Rnf19a UTSW 15 36244196 missense probably benign 0.05
R5386:Rnf19a UTSW 15 36242039 missense probably benign 0.01
R5647:Rnf19a UTSW 15 36265963 start gained probably benign
R6451:Rnf19a UTSW 15 36253059 missense possibly damaging 0.64
R7003:Rnf19a UTSW 15 36254504 nonsense probably null
R7304:Rnf19a UTSW 15 36254452 missense probably damaging 0.98
R7893:Rnf19a UTSW 15 36241668 missense possibly damaging 0.95
R8808:Rnf19a UTSW 15 36241875 missense probably benign 0.00
R8864:Rnf19a UTSW 15 36265306 missense possibly damaging 0.80
R8940:Rnf19a UTSW 15 36260138 missense probably damaging 1.00
R9063:Rnf19a UTSW 15 36265469 nonsense probably null
R9093:Rnf19a UTSW 15 36253304 intron probably benign
R9135:Rnf19a UTSW 15 36253164 critical splice acceptor site probably null
R9525:Rnf19a UTSW 15 36247229 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TATGTCTGAGGGAAGCGCTG -3'
(R):5'- GGATTGTGTGAGAAATTACTTCAGC -3'

Sequencing Primer
(F):5'- AGCCTTAAAACTAGGTTCTCCAG -3'
(R):5'- TCAGCTTTCTTATATGAGAAGAACTG -3'
Posted On 2016-07-22