Incidental Mutation 'R5297:Golgb1'
ID 405511
Institutional Source Beutler Lab
Gene Symbol Golgb1
Ensembl Gene ENSMUSG00000034243
Gene Name golgi autoantigen, golgin subfamily b, macrogolgin 1
Synonyms Giantin, C130074L01Rik, F730017E11Rik, Gm6840, 6330407A06Rik
MMRRC Submission 042880-MU
Accession Numbers

Genbank: NM_030035.1

Essential gene? Probably essential (E-score: 0.877) question?
Stock # R5297 (G1)
Quality Score 157
Status Not validated
Chromosome 16
Chromosomal Location 36875140-36933085 bp(+) (GRCm38)
Type of Mutation intron
DNA Base Change (assembly) G to A at 36875616 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000116503 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023534] [ENSMUST00000023535] [ENSMUST00000075946] [ENSMUST00000114812] [ENSMUST00000114819] [ENSMUST00000134616] [ENSMUST00000135406]
AlphaFold no structure available at present
Predicted Effect unknown
Transcript: ENSMUST00000023534
AA Change: R159H
SMART Domains Protein: ENSMUSP00000023534
Gene: ENSMUSG00000034243
AA Change: R159H

DomainStartEndE-ValueType
low complexity region 55 99 N/A INTRINSIC
low complexity region 109 126 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000023535
SMART Domains Protein: ENSMUSP00000023535
Gene: ENSMUSG00000022837

DomainStartEndE-ValueType
IQ 293 315 5.92e-4 SMART
low complexity region 341 358 N/A INTRINSIC
IQ 386 408 2.66e-6 SMART
low complexity region 428 442 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000075946
SMART Domains Protein: ENSMUSP00000075331
Gene: ENSMUSG00000022838

DomainStartEndE-ValueType
low complexity region 44 71 N/A INTRINSIC
low complexity region 117 132 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114812
SMART Domains Protein: ENSMUSP00000110460
Gene: ENSMUSG00000034243

DomainStartEndE-ValueType
internal_repeat_2 24 61 6.71e-6 PROSPERO
low complexity region 87 107 N/A INTRINSIC
low complexity region 120 134 N/A INTRINSIC
low complexity region 143 154 N/A INTRINSIC
low complexity region 200 219 N/A INTRINSIC
low complexity region 450 471 N/A INTRINSIC
internal_repeat_3 478 517 6.71e-6 PROSPERO
coiled coil region 522 553 N/A INTRINSIC
internal_repeat_4 586 620 3.05e-5 PROSPERO
coiled coil region 638 1080 N/A INTRINSIC
coiled coil region 1112 1199 N/A INTRINSIC
internal_repeat_4 1212 1247 3.05e-5 PROSPERO
low complexity region 1259 1273 N/A INTRINSIC
internal_repeat_1 1280 1311 3.14e-6 PROSPERO
low complexity region 1316 1328 N/A INTRINSIC
coiled coil region 1361 1714 N/A INTRINSIC
internal_repeat_2 1719 1757 6.71e-6 PROSPERO
internal_repeat_3 1720 1763 6.71e-6 PROSPERO
coiled coil region 1777 1993 N/A INTRINSIC
low complexity region 2250 2265 N/A INTRINSIC
internal_repeat_1 2310 2341 3.14e-6 PROSPERO
low complexity region 2359 2377 N/A INTRINSIC
low complexity region 2497 2508 N/A INTRINSIC
coiled coil region 2734 2786 N/A INTRINSIC
coiled coil region 2813 2902 N/A INTRINSIC
low complexity region 2923 2935 N/A INTRINSIC
coiled coil region 2966 3016 N/A INTRINSIC
coiled coil region 3076 3122 N/A INTRINSIC
transmembrane domain 3174 3196 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114819
SMART Domains Protein: ENSMUSP00000110467
Gene: ENSMUSG00000022837

DomainStartEndE-ValueType
IQ 293 315 5.92e-4 SMART
low complexity region 341 358 N/A INTRINSIC
IQ 386 408 2.66e-6 SMART
low complexity region 428 442 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134556
Predicted Effect probably benign
Transcript: ENSMUST00000134616
SMART Domains Protein: ENSMUSP00000116503
Gene: ENSMUSG00000034243

DomainStartEndE-ValueType
coiled coil region 42 107 N/A INTRINSIC
low complexity region 120 134 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135406
SMART Domains Protein: ENSMUSP00000115848
Gene: ENSMUSG00000034243

DomainStartEndE-ValueType
coiled coil region 42 107 N/A INTRINSIC
low complexity region 120 134 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135800
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138660
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153572
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157072
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous knockout affects glycosylation of glycoproteins in the extra-cellular matrix of the palatal shelves, resulting in their failure to elevate and fuse, leading to cleft palate. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted, other(2) Gene trapped(5)

Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acbd6 G T 1: 155,587,458 A135S probably benign Het
Agbl4 A G 4: 111,566,698 K307R possibly damaging Het
AI481877 A G 4: 59,047,543 W1359R probably benign Het
Akna T C 4: 63,381,846 E653G possibly damaging Het
Arhgap26 T C 18: 39,121,888 Y273H probably damaging Het
Atg14 G A 14: 47,568,199 R70C probably damaging Het
Atp1a1 C T 3: 101,591,127 V250M possibly damaging Het
Cacna1c T G 6: 118,742,361 D215A probably damaging Het
Cadps T A 14: 12,822,345 N132Y probably damaging Het
Casp6 T C 3: 129,910,555 F97L possibly damaging Het
Ckap2l T C 2: 129,285,370 N296S possibly damaging Het
Col6a4 T C 9: 106,074,867 K611E probably benign Het
Copa A G 1: 172,113,108 H696R probably damaging Het
Cyp2a4 T A 7: 26,312,204 N283K probably benign Het
Dcc C T 18: 71,378,738 V869I probably benign Het
Efemp1 G T 11: 28,867,868 G116C probably damaging Het
F830045P16Rik T C 2: 129,460,553 E373G probably benign Het
Fbxo9 T C 9: 78,086,279 T318A probably benign Het
Gipr A G 7: 19,157,544 W403R probably damaging Het
Gm10093 A G 17: 78,492,758 S393G probably benign Het
Gm12794 T A 4: 101,941,151 D106E possibly damaging Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Herc3 T C 6: 58,856,641 L171P probably damaging Het
Il5ra A G 6: 106,738,134 I221T probably benign Het
Itgb2 A G 10: 77,564,667 I705V probably damaging Het
Map4k4 G T 1: 39,962,217 V55F probably damaging Het
Mast1 A G 8: 84,913,318 probably null Het
Mitf G T 6: 97,994,430 G186V probably benign Het
Mtpn C T 6: 35,512,290 D100N probably benign Het
Nrcam T C 12: 44,544,784 F204L probably damaging Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr1111 T C 2: 87,150,449 I71V probably benign Het
Olfr1510 A G 14: 52,410,218 L218P probably damaging Het
Olfr248 A G 1: 174,391,200 M44V probably benign Het
Olfr381 A T 11: 73,486,389 V145E probably damaging Het
Olfr446 T C 6: 42,927,437 S69P probably benign Het
Olfr503 A T 7: 108,545,404 N291I probably damaging Het
Pclo A T 5: 14,676,249 probably benign Het
Pik3ca T A 3: 32,450,053 Y631N probably damaging Het
Ptk2b T C 14: 66,172,517 D462G probably benign Het
Rnf19a A G 15: 36,247,778 S427P probably damaging Het
Scn3a T A 2: 65,469,034 Y1376F possibly damaging Het
Spem1 A G 11: 69,820,927 Y304H probably damaging Het
Stk38l C A 6: 146,775,655 Y450* probably null Het
Stx19 A G 16: 62,821,974 E51G probably damaging Het
Ttc41 C G 10: 86,776,579 Q1239E probably benign Het
Tuba3a C T 6: 125,281,340 R229H probably damaging Het
Utp18 A T 11: 93,876,089 V264D probably damaging Het
V1rd19 T C 7: 24,003,289 V60A probably damaging Het
Virma T G 4: 11,494,819 V40G probably damaging Het
Vmn1r160 C T 7: 22,871,290 Q23* probably null Het
Vmn2r13 T C 5: 109,191,939 I57V probably benign Het
Vmn2r26 T A 6: 124,061,873 F802L probably damaging Het
Vmn2r61 A G 7: 42,260,222 D57G probably benign Het
Vps13c A G 9: 67,878,131 N260S probably damaging Het
Xirp1 C A 9: 120,019,602 A72S probably damaging Het
Zfp212 T C 6: 47,929,077 V190A probably benign Het
Zfp703 C T 8: 26,979,205 P299L probably damaging Het
Other mutations in Golgb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01394:Golgb1 APN 16 36931564 missense probably damaging 1.00
IGL01717:Golgb1 APN 16 36915502 nonsense probably null
IGL01965:Golgb1 APN 16 36917920 missense probably damaging 1.00
IGL02128:Golgb1 APN 16 36916304 missense probably damaging 1.00
IGL02268:Golgb1 APN 16 36913128 missense probably benign 0.25
IGL02383:Golgb1 APN 16 36886200 missense probably benign 0.01
IGL02444:Golgb1 APN 16 36907816 splice site probably benign
IGL02635:Golgb1 APN 16 36915013 missense probably benign 0.00
IGL02655:Golgb1 APN 16 36918080 missense probably damaging 0.98
IGL02887:Golgb1 APN 16 36925849 missense probably damaging 0.99
IGL02937:Golgb1 APN 16 36916210 missense probably damaging 1.00
IGL02973:Golgb1 APN 16 36912080 missense possibly damaging 0.92
IGL02982:Golgb1 APN 16 36925810 missense probably damaging 0.98
IGL03065:Golgb1 APN 16 36912866 missense probably benign 0.11
IGL03109:Golgb1 APN 16 36915611 missense possibly damaging 0.93
IGL03323:Golgb1 APN 16 36913453 nonsense probably null
I2288:Golgb1 UTSW 16 36898542 missense probably benign 0.00
I2289:Golgb1 UTSW 16 36898542 missense probably benign 0.00
R0071:Golgb1 UTSW 16 36915503 missense probably benign 0.00
R0071:Golgb1 UTSW 16 36915503 missense probably benign 0.00
R0080:Golgb1 UTSW 16 36898611 missense probably damaging 1.00
R0102:Golgb1 UTSW 16 36875468 intron probably benign
R0242:Golgb1 UTSW 16 36875630 nonsense probably null
R0242:Golgb1 UTSW 16 36875630 nonsense probably null
R0276:Golgb1 UTSW 16 36913876 missense probably damaging 1.00
R0394:Golgb1 UTSW 16 36875579 intron probably benign
R0469:Golgb1 UTSW 16 36931635 missense probably benign 0.41
R0522:Golgb1 UTSW 16 36915205 frame shift probably null
R0575:Golgb1 UTSW 16 36918809 missense probably benign
R0600:Golgb1 UTSW 16 36916271 missense probably damaging 1.00
R0608:Golgb1 UTSW 16 36916330 nonsense probably null
R0711:Golgb1 UTSW 16 36918790 missense probably damaging 1.00
R0785:Golgb1 UTSW 16 36898790 missense possibly damaging 0.95
R0893:Golgb1 UTSW 16 36912277 missense possibly damaging 0.64
R1163:Golgb1 UTSW 16 36916126 missense possibly damaging 0.50
R1208:Golgb1 UTSW 16 36915205 frame shift probably null
R1315:Golgb1 UTSW 16 36914900 missense probably benign 0.40
R1429:Golgb1 UTSW 16 36900563 missense possibly damaging 0.93
R1505:Golgb1 UTSW 16 36919643 missense possibly damaging 0.79
R1537:Golgb1 UTSW 16 36898788 missense possibly damaging 0.89
R1610:Golgb1 UTSW 16 36926101 missense probably benign 0.25
R1659:Golgb1 UTSW 16 36887617 missense probably benign 0.01
R1769:Golgb1 UTSW 16 36916001 missense probably damaging 1.00
R2105:Golgb1 UTSW 16 36914664 missense probably benign
R2212:Golgb1 UTSW 16 36887347 missense probably damaging 1.00
R2261:Golgb1 UTSW 16 36893360 missense probably damaging 1.00
R2352:Golgb1 UTSW 16 36898559 missense probably damaging 0.99
R2357:Golgb1 UTSW 16 36912008 missense probably damaging 1.00
R2400:Golgb1 UTSW 16 36918466 missense possibly damaging 0.62
R2513:Golgb1 UTSW 16 36915151 missense possibly damaging 0.73
R3103:Golgb1 UTSW 16 36894849 missense probably damaging 1.00
R3413:Golgb1 UTSW 16 36887347 missense probably damaging 1.00
R3748:Golgb1 UTSW 16 36918912 missense probably benign 0.00
R3847:Golgb1 UTSW 16 36898733 missense probably benign 0.00
R3850:Golgb1 UTSW 16 36898733 missense probably benign 0.00
R3936:Golgb1 UTSW 16 36914056 nonsense probably null
R3975:Golgb1 UTSW 16 36918571 missense probably damaging 0.99
R4025:Golgb1 UTSW 16 36915344 missense probably benign 0.00
R4369:Golgb1 UTSW 16 36916907 missense probably damaging 1.00
R4518:Golgb1 UTSW 16 36929263 missense probably damaging 0.98
R4600:Golgb1 UTSW 16 36918625 missense probably damaging 1.00
R4610:Golgb1 UTSW 16 36918625 missense probably damaging 1.00
R4660:Golgb1 UTSW 16 36887618 missense probably damaging 0.99
R4811:Golgb1 UTSW 16 36891419 missense probably damaging 1.00
R4815:Golgb1 UTSW 16 36913115 missense possibly damaging 0.79
R4835:Golgb1 UTSW 16 36891407 missense possibly damaging 0.86
R4904:Golgb1 UTSW 16 36893386 missense probably damaging 1.00
R4916:Golgb1 UTSW 16 36916118 missense probably benign 0.05
R5121:Golgb1 UTSW 16 36919258 missense probably damaging 0.99
R5133:Golgb1 UTSW 16 36891457 missense possibly damaging 0.75
R5143:Golgb1 UTSW 16 36898689 missense probably benign 0.09
R5185:Golgb1 UTSW 16 36875141 unclassified probably benign
R5188:Golgb1 UTSW 16 36918465 missense probably benign 0.13
R5260:Golgb1 UTSW 16 36913141 missense probably benign 0.00
R5386:Golgb1 UTSW 16 36912315 nonsense probably null
R5438:Golgb1 UTSW 16 36900508 missense probably benign 0.15
R5439:Golgb1 UTSW 16 36900508 missense probably benign 0.15
R5494:Golgb1 UTSW 16 36928683 missense possibly damaging 0.67
R5592:Golgb1 UTSW 16 36925763 missense probably benign 0.02
R5740:Golgb1 UTSW 16 36919000 missense probably damaging 0.99
R5862:Golgb1 UTSW 16 36926091 splice site silent
R5928:Golgb1 UTSW 16 36911987 missense probably damaging 1.00
R6009:Golgb1 UTSW 16 36914959 missense probably damaging 1.00
R6062:Golgb1 UTSW 16 36914671 missense possibly damaging 0.89
R6102:Golgb1 UTSW 16 36912865 missense probably damaging 1.00
R6198:Golgb1 UTSW 16 36893395 missense probably damaging 1.00
R6253:Golgb1 UTSW 16 36915622 missense possibly damaging 0.77
R6254:Golgb1 UTSW 16 36913978 missense probably damaging 0.99
R6321:Golgb1 UTSW 16 36918197 nonsense probably null
R6700:Golgb1 UTSW 16 36875584 intron probably benign
R6870:Golgb1 UTSW 16 36918203 missense probably damaging 1.00
R6882:Golgb1 UTSW 16 36913990 missense probably benign
R6944:Golgb1 UTSW 16 36912113 missense probably benign
R7108:Golgb1 UTSW 16 36913721 missense probably benign 0.01
R7124:Golgb1 UTSW 16 36913673 missense probably benign 0.01
R7125:Golgb1 UTSW 16 36917963 missense possibly damaging 0.85
R7187:Golgb1 UTSW 16 36916150 missense probably benign 0.43
R7205:Golgb1 UTSW 16 36875301 missense unknown
R7206:Golgb1 UTSW 16 36913749 missense probably benign 0.41
R7233:Golgb1 UTSW 16 36914758 missense possibly damaging 0.91
R7320:Golgb1 UTSW 16 36915951 nonsense probably null
R7367:Golgb1 UTSW 16 36898546 missense probably benign 0.00
R7408:Golgb1 UTSW 16 36898547 missense probably damaging 0.98
R7419:Golgb1 UTSW 16 36912919 missense possibly damaging 0.95
R7556:Golgb1 UTSW 16 36915793 missense probably benign 0.03
R7599:Golgb1 UTSW 16 36875396 missense unknown
R7673:Golgb1 UTSW 16 36913669 missense probably benign 0.05
R7789:Golgb1 UTSW 16 36875399 missense unknown
R7792:Golgb1 UTSW 16 36918730 missense probably benign 0.43
R7830:Golgb1 UTSW 16 36898721 missense possibly damaging 0.93
R7847:Golgb1 UTSW 16 36931920 missense probably damaging 1.00
R7905:Golgb1 UTSW 16 36913685 missense probably benign
R7944:Golgb1 UTSW 16 36914104 missense probably benign 0.02
R7945:Golgb1 UTSW 16 36914104 missense probably benign 0.02
R7950:Golgb1 UTSW 16 36915424 missense probably benign 0.13
R8040:Golgb1 UTSW 16 36913479 missense possibly damaging 0.85
R8077:Golgb1 UTSW 16 36918633 missense probably damaging 0.99
R8181:Golgb1 UTSW 16 36916830 missense probably damaging 1.00
R8370:Golgb1 UTSW 16 36912317 missense probably benign 0.00
R8684:Golgb1 UTSW 16 36914402 missense possibly damaging 0.92
R8725:Golgb1 UTSW 16 36919201 missense probably damaging 1.00
R8727:Golgb1 UTSW 16 36919201 missense probably damaging 1.00
R8738:Golgb1 UTSW 16 36916313 missense probably damaging 1.00
R8785:Golgb1 UTSW 16 36919744 missense probably damaging 0.99
R8824:Golgb1 UTSW 16 36915689 missense probably benign
R8825:Golgb1 UTSW 16 36919447 missense probably benign 0.00
R8940:Golgb1 UTSW 16 36916397 missense probably damaging 1.00
R8962:Golgb1 UTSW 16 36913616 missense probably damaging 1.00
R9245:Golgb1 UTSW 16 36918819 nonsense probably null
R9365:Golgb1 UTSW 16 36915762 missense probably damaging 1.00
R9612:Golgb1 UTSW 16 36919605 missense probably benign 0.41
R9620:Golgb1 UTSW 16 36919449 missense probably benign
R9691:Golgb1 UTSW 16 36898634 missense probably damaging 1.00
R9747:Golgb1 UTSW 16 36893407 missense probably damaging 1.00
V1662:Golgb1 UTSW 16 36898542 missense probably benign 0.00
X0067:Golgb1 UTSW 16 36914303 nonsense probably null
Z1088:Golgb1 UTSW 16 36919742 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTGACGTGGCTTCGATTG -3'
(R):5'- AATATTTCCTTCAATCGCCCTGAG -3'

Sequencing Primer
(F):5'- TAGGTGGTCGCCCAGTG -3'
(R):5'- TGGATCATCTCTCCGTCA -3'
Posted On 2016-07-22