Incidental Mutation 'R5297:Hdac1-ps'
ID 405513
Institutional Source Beutler Lab
Gene Symbol Hdac1-ps
Ensembl Gene ENSMUSG00000061062
Gene Name histone deacetylase 1, pseudogene
Synonyms EG15181, Gm10093
MMRRC Submission 042880-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.883) question?
Stock # R5297 (G1)
Quality Score 225
Status Not validated
Chromosome 17
Chromosomal Location 78799011-78800454 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 78800187 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Glycine at position 393 (S393G)
Ref Sequence ENSEMBL: ENSMUSP00000078339 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079363]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000079363
AA Change: S393G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000078339
Gene: ENSMUSG00000061062
AA Change: S393G

DomainStartEndE-ValueType
Pfam:Hist_deacetyl 18 320 3.2e-84 PFAM
low complexity region 390 402 N/A INTRINSIC
low complexity region 417 430 N/A INTRINSIC
low complexity region 443 471 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acbd6 G T 1: 155,463,204 (GRCm39) A135S probably benign Het
Agbl4 A G 4: 111,423,895 (GRCm39) K307R possibly damaging Het
Akna T C 4: 63,300,083 (GRCm39) E653G possibly damaging Het
Arhgap26 T C 18: 39,254,941 (GRCm39) Y273H probably damaging Het
Atg14 G A 14: 47,805,656 (GRCm39) R70C probably damaging Het
Atp1a1 C T 3: 101,498,443 (GRCm39) V250M possibly damaging Het
Cacna1c T G 6: 118,719,322 (GRCm39) D215A probably damaging Het
Cadps T A 14: 12,822,345 (GRCm38) N132Y probably damaging Het
Casp6 T C 3: 129,704,204 (GRCm39) F97L possibly damaging Het
Ckap2l T C 2: 129,127,290 (GRCm39) N296S possibly damaging Het
Col6a4 T C 9: 105,952,066 (GRCm39) K611E probably benign Het
Copa A G 1: 171,940,675 (GRCm39) H696R probably damaging Het
Cyp2a4 T A 7: 26,011,629 (GRCm39) N283K probably benign Het
Dcc C T 18: 71,511,809 (GRCm39) V869I probably benign Het
Efemp1 G T 11: 28,817,868 (GRCm39) G116C probably damaging Het
F830045P16Rik T C 2: 129,302,473 (GRCm39) E373G probably benign Het
Fbxo9 T C 9: 77,993,561 (GRCm39) T318A probably benign Het
Gipr A G 7: 18,891,469 (GRCm39) W403R probably damaging Het
Gm4787 G C 12: 81,424,604 (GRCm39) T518S probably benign Het
Golgb1 G A 16: 36,695,978 (GRCm39) probably benign Het
Herc3 T C 6: 58,833,626 (GRCm39) L171P probably damaging Het
Il5ra A G 6: 106,715,095 (GRCm39) I221T probably benign Het
Itgb2 A G 10: 77,400,501 (GRCm39) I705V probably damaging Het
Map4k4 G T 1: 40,001,377 (GRCm39) V55F probably damaging Het
Mast1 A G 8: 85,639,947 (GRCm39) probably null Het
Mitf G T 6: 97,971,391 (GRCm39) G186V probably benign Het
Mtpn C T 6: 35,489,225 (GRCm39) D100N probably benign Het
Nrcam T C 12: 44,591,567 (GRCm39) F204L probably damaging Het
Or10g1 A G 14: 52,647,675 (GRCm39) L218P probably damaging Het
Or10x4 A G 1: 174,218,766 (GRCm39) M44V probably benign Het
Or1e16 AGCGGTCGTAGGC AGC 11: 73,286,480 (GRCm39) probably null Het
Or1e22 A T 11: 73,377,215 (GRCm39) V145E probably damaging Het
Or2a12 T C 6: 42,904,371 (GRCm39) S69P probably benign Het
Or52n4b A T 7: 108,144,611 (GRCm39) N291I probably damaging Het
Or5as1 T C 2: 86,980,793 (GRCm39) I71V probably benign Het
Pclo A T 5: 14,726,263 (GRCm39) probably benign Het
Pik3ca T A 3: 32,504,202 (GRCm39) Y631N probably damaging Het
Pramel19 T A 4: 101,798,348 (GRCm39) D106E possibly damaging Het
Ptk2b T C 14: 66,409,966 (GRCm39) D462G probably benign Het
Rnf19a A G 15: 36,247,924 (GRCm39) S427P probably damaging Het
Scn3a T A 2: 65,299,378 (GRCm39) Y1376F possibly damaging Het
Shoc1 A G 4: 59,047,543 (GRCm39) W1359R probably benign Het
Spem1 A G 11: 69,711,753 (GRCm39) Y304H probably damaging Het
Stk38l C A 6: 146,677,153 (GRCm39) Y450* probably null Het
Stx19 A G 16: 62,642,337 (GRCm39) E51G probably damaging Het
Ttc41 C G 10: 86,612,443 (GRCm39) Q1239E probably benign Het
Tuba3a C T 6: 125,258,303 (GRCm39) R229H probably damaging Het
Utp18 A T 11: 93,766,915 (GRCm39) V264D probably damaging Het
V1rd19 T C 7: 23,702,714 (GRCm39) V60A probably damaging Het
Virma T G 4: 11,494,819 (GRCm39) V40G probably damaging Het
Vmn1r160 C T 7: 22,570,715 (GRCm39) Q23* probably null Het
Vmn2r13 T C 5: 109,339,805 (GRCm39) I57V probably benign Het
Vmn2r26 T A 6: 124,038,832 (GRCm39) F802L probably damaging Het
Vmn2r61 A G 7: 41,909,646 (GRCm39) D57G probably benign Het
Vps13c A G 9: 67,785,413 (GRCm39) N260S probably damaging Het
Xirp1 C A 9: 119,848,668 (GRCm39) A72S probably damaging Het
Zfp212 T C 6: 47,906,011 (GRCm39) V190A probably benign Het
Zfp703 C T 8: 27,469,233 (GRCm39) P299L probably damaging Het
Other mutations in Hdac1-ps
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01936:Hdac1-ps APN 17 78,799,558 (GRCm39) missense probably damaging 1.00
IGL01983:Hdac1-ps APN 17 78,800,282 (GRCm39) missense probably benign
IGL02543:Hdac1-ps APN 17 78,799,303 (GRCm39) missense probably damaging 0.97
buttress UTSW 17 78,800,343 (GRCm39) missense possibly damaging 0.91
Chartre UTSW 17 78,799,969 (GRCm39) missense probably damaging 0.99
R1174:Hdac1-ps UTSW 17 78,799,507 (GRCm39) missense probably benign 0.01
R1605:Hdac1-ps UTSW 17 78,799,537 (GRCm39) missense probably damaging 0.98
R2416:Hdac1-ps UTSW 17 78,799,945 (GRCm39) missense probably damaging 1.00
R2919:Hdac1-ps UTSW 17 78,800,275 (GRCm39) missense probably damaging 0.98
R2920:Hdac1-ps UTSW 17 78,800,275 (GRCm39) missense probably damaging 0.98
R3846:Hdac1-ps UTSW 17 78,800,401 (GRCm39) missense possibly damaging 0.91
R4544:Hdac1-ps UTSW 17 78,800,388 (GRCm39) missense probably benign 0.02
R4546:Hdac1-ps UTSW 17 78,800,388 (GRCm39) missense probably benign 0.02
R5223:Hdac1-ps UTSW 17 78,799,867 (GRCm39) missense probably benign 0.02
R6164:Hdac1-ps UTSW 17 78,799,716 (GRCm39) missense probably damaging 0.99
R6568:Hdac1-ps UTSW 17 78,800,017 (GRCm39) missense probably damaging 1.00
R6726:Hdac1-ps UTSW 17 78,800,287 (GRCm39) missense probably damaging 0.99
R6901:Hdac1-ps UTSW 17 78,800,089 (GRCm39) missense probably benign 0.07
R6923:Hdac1-ps UTSW 17 78,800,343 (GRCm39) missense possibly damaging 0.91
R7838:Hdac1-ps UTSW 17 78,799,447 (GRCm39) missense probably damaging 1.00
R8002:Hdac1-ps UTSW 17 78,799,716 (GRCm39) missense probably damaging 0.99
R8728:Hdac1-ps UTSW 17 78,800,332 (GRCm39) missense probably benign 0.01
R8821:Hdac1-ps UTSW 17 78,799,969 (GRCm39) missense probably damaging 0.99
R8920:Hdac1-ps UTSW 17 78,799,171 (GRCm39) missense probably benign 0.37
R9618:Hdac1-ps UTSW 17 78,799,114 (GRCm39) missense probably damaging 1.00
R9649:Hdac1-ps UTSW 17 78,799,075 (GRCm39) missense probably benign 0.03
X0060:Hdac1-ps UTSW 17 78,799,557 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTTGGACCGGATTTCAAGCTTC -3'
(R):5'- TTGCTCAGGCCAACTTGACC -3'

Sequencing Primer
(F):5'- GGACCGGATTTCAAGCTTCACATC -3'
(R):5'- CAGGCCAACTTGACCTCTTC -3'
Posted On 2016-07-22