Incidental Mutation 'R5297:Gm10093'
ID405513
Institutional Source Beutler Lab
Gene Symbol Gm10093
Ensembl Gene ENSMUSG00000061062
Gene Namepredicted pseudogene 10093
SynonymsEG15181
MMRRC Submission 042880-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.796) question?
Stock #R5297 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location78491565-78493541 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 78492758 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 393 (S393G)
Ref Sequence ENSEMBL: ENSMUSP00000078339 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079363]
Predicted Effect probably benign
Transcript: ENSMUST00000079363
AA Change: S393G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000078339
Gene: ENSMUSG00000061062
AA Change: S393G

DomainStartEndE-ValueType
Pfam:Hist_deacetyl 18 320 3.2e-84 PFAM
low complexity region 390 402 N/A INTRINSIC
low complexity region 417 430 N/A INTRINSIC
low complexity region 443 471 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acbd6 G T 1: 155,587,458 A135S probably benign Het
Agbl4 A G 4: 111,566,698 K307R possibly damaging Het
AI481877 A G 4: 59,047,543 W1359R probably benign Het
Akna T C 4: 63,381,846 E653G possibly damaging Het
Arhgap26 T C 18: 39,121,888 Y273H probably damaging Het
Atg14 G A 14: 47,568,199 R70C probably damaging Het
Atp1a1 C T 3: 101,591,127 V250M possibly damaging Het
Cacna1c T G 6: 118,742,361 D215A probably damaging Het
Cadps T A 14: 12,822,345 N132Y probably damaging Het
Casp6 T C 3: 129,910,555 F97L possibly damaging Het
Ckap2l T C 2: 129,285,370 N296S possibly damaging Het
Col6a4 T C 9: 106,074,867 K611E probably benign Het
Copa A G 1: 172,113,108 H696R probably damaging Het
Cyp2a4 T A 7: 26,312,204 N283K probably benign Het
Dcc C T 18: 71,378,738 V869I probably benign Het
Efemp1 G T 11: 28,867,868 G116C probably damaging Het
F830045P16Rik T C 2: 129,460,553 E373G probably benign Het
Fbxo9 T C 9: 78,086,279 T318A probably benign Het
Gipr A G 7: 19,157,544 W403R probably damaging Het
Gm12794 T A 4: 101,941,151 D106E possibly damaging Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Golgb1 G A 16: 36,875,616 probably benign Het
Herc3 T C 6: 58,856,641 L171P probably damaging Het
Il5ra A G 6: 106,738,134 I221T probably benign Het
Itgb2 A G 10: 77,564,667 I705V probably damaging Het
Map4k4 G T 1: 39,962,217 V55F probably damaging Het
Mast1 A G 8: 84,913,318 probably null Het
Mitf G T 6: 97,994,430 G186V probably benign Het
Mtpn C T 6: 35,512,290 D100N probably benign Het
Nrcam T C 12: 44,544,784 F204L probably damaging Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr1111 T C 2: 87,150,449 I71V probably benign Het
Olfr1510 A G 14: 52,410,218 L218P probably damaging Het
Olfr248 A G 1: 174,391,200 M44V probably benign Het
Olfr381 A T 11: 73,486,389 V145E probably damaging Het
Olfr446 T C 6: 42,927,437 S69P probably benign Het
Olfr503 A T 7: 108,545,404 N291I probably damaging Het
Pclo A T 5: 14,676,249 probably benign Het
Pik3ca T A 3: 32,450,053 Y631N probably damaging Het
Ptk2b T C 14: 66,172,517 D462G probably benign Het
Rnf19a A G 15: 36,247,778 S427P probably damaging Het
Scn3a T A 2: 65,469,034 Y1376F possibly damaging Het
Spem1 A G 11: 69,820,927 Y304H probably damaging Het
Stk38l C A 6: 146,775,655 Y450* probably null Het
Stx19 A G 16: 62,821,974 E51G probably damaging Het
Ttc41 C G 10: 86,776,579 Q1239E probably benign Het
Tuba3a C T 6: 125,281,340 R229H probably damaging Het
Utp18 A T 11: 93,876,089 V264D probably damaging Het
V1rd19 T C 7: 24,003,289 V60A probably damaging Het
Virma T G 4: 11,494,819 V40G probably damaging Het
Vmn1r160 C T 7: 22,871,290 Q23* probably null Het
Vmn2r13 T C 5: 109,191,939 I57V probably benign Het
Vmn2r26 T A 6: 124,061,873 F802L probably damaging Het
Vmn2r61 A G 7: 42,260,222 D57G probably benign Het
Vps13c A G 9: 67,878,131 N260S probably damaging Het
Xirp1 C A 9: 120,019,602 A72S probably damaging Het
Zfp212 T C 6: 47,929,077 V190A probably benign Het
Zfp703 C T 8: 26,979,205 P299L probably damaging Het
Other mutations in Gm10093
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01936:Gm10093 APN 17 78492129 missense probably damaging 1.00
IGL01983:Gm10093 APN 17 78492853 missense probably benign
IGL02543:Gm10093 APN 17 78491874 missense probably damaging 0.97
R1174:Gm10093 UTSW 17 78492078 missense probably benign 0.01
R1605:Gm10093 UTSW 17 78492108 missense probably damaging 0.98
R2416:Gm10093 UTSW 17 78492516 missense probably damaging 1.00
R2919:Gm10093 UTSW 17 78492846 missense probably damaging 0.98
R2920:Gm10093 UTSW 17 78492846 missense probably damaging 0.98
R3846:Gm10093 UTSW 17 78492972 missense possibly damaging 0.91
R4544:Gm10093 UTSW 17 78492959 missense probably benign 0.02
R4546:Gm10093 UTSW 17 78492959 missense probably benign 0.02
R5223:Gm10093 UTSW 17 78492438 missense probably benign 0.02
R6164:Gm10093 UTSW 17 78492287 missense probably damaging 0.99
R6568:Gm10093 UTSW 17 78492588 missense probably damaging 1.00
R6726:Gm10093 UTSW 17 78492858 missense probably damaging 0.99
R6901:Gm10093 UTSW 17 78492660 missense probably benign 0.07
R6923:Gm10093 UTSW 17 78492914 missense possibly damaging 0.91
R7838:Gm10093 UTSW 17 78492018 missense probably damaging 1.00
R8002:Gm10093 UTSW 17 78492287 missense probably damaging 0.99
X0060:Gm10093 UTSW 17 78492128 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTTGGACCGGATTTCAAGCTTC -3'
(R):5'- TTGCTCAGGCCAACTTGACC -3'

Sequencing Primer
(F):5'- GGACCGGATTTCAAGCTTCACATC -3'
(R):5'- CAGGCCAACTTGACCTCTTC -3'
Posted On2016-07-22