Incidental Mutation 'R5298:Olfr1262'
ID405519
Institutional Source Beutler Lab
Gene Symbol Olfr1262
Ensembl Gene ENSMUSG00000051313
Gene Nameolfactory receptor 1262
SynonymsGA_x6K02T2Q125-51434523-51435437, MOR234-1
MMRRC Submission 042881-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R5298 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location90000145-90008291 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 90002460 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 18 (L18Q)
Ref Sequence ENSEMBL: ENSMUSP00000150533 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061701] [ENSMUST00000111508] [ENSMUST00000131072] [ENSMUST00000213868]
Predicted Effect possibly damaging
Transcript: ENSMUST00000061701
AA Change: L18Q

PolyPhen 2 Score 0.820 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000052387
Gene: ENSMUSG00000051313
AA Change: L18Q

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 30 297 1.2e-5 PFAM
Pfam:7tm_1 36 282 9.9e-24 PFAM
Pfam:7tm_4 134 275 1.3e-38 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000111508
AA Change: L18Q

PolyPhen 2 Score 0.820 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000107133
Gene: ENSMUSG00000051313
AA Change: L18Q

DomainStartEndE-ValueType
Pfam:7tm_4 25 300 6.1e-43 PFAM
Pfam:7TM_GPCR_Srsx 30 297 1.2e-5 PFAM
Pfam:7tm_1 36 282 7.1e-16 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000131072
AA Change: L18Q

PolyPhen 2 Score 0.820 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000121666
Gene: ENSMUSG00000051313
AA Change: L18Q

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 30 171 1.7e-8 PFAM
Pfam:7tm_1 36 238 3.2e-22 PFAM
Pfam:7tm_4 134 240 5e-28 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000213868
AA Change: L18Q

PolyPhen 2 Score 0.923 (Sensitivity: 0.81; Specificity: 0.94)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ackr4 A G 9: 104,098,887 V287A possibly damaging Het
Adat2 A G 10: 13,556,906 N51D probably benign Het
Alms1-ps1 T C 6: 85,752,118 noncoding transcript Het
Ccdc97 A G 7: 25,716,007 V12A probably damaging Het
Cdcp2 T C 4: 107,106,985 V344A probably benign Het
Clasp1 A G 1: 118,547,920 D929G possibly damaging Het
Clip4 A G 17: 71,834,225 N525D probably damaging Het
Csde1 T A 3: 103,047,209 probably null Het
D330020A13Rik T C 6: 120,294,816 probably benign Het
Dnah2 C T 11: 69,458,920 R2399Q probably benign Het
Ehmt2 C T 17: 34,899,091 R40* probably null Het
Fam208b T C 13: 3,595,613 probably null Het
Fuca1 C A 4: 135,936,926 Y374* probably null Het
Gle1 C G 2: 29,948,943 P457A probably benign Het
Hadhb T C 5: 30,177,011 probably null Het
Klhl18 G C 9: 110,436,127 N335K possibly damaging Het
Lef1 A T 3: 131,194,667 R294S possibly damaging Het
Lrriq4 G T 3: 30,645,332 M1I probably null Het
Magi2 T C 5: 20,569,162 S884P probably damaging Het
Mon2 A G 10: 123,010,606 I1353T probably benign Het
Olfr510 A G 7: 108,668,072 I219V probably benign Het
Parg C A 14: 32,202,253 A3E probably damaging Het
Per3 A T 4: 151,029,209 D297E probably damaging Het
Pkhd1l1 A T 15: 44,504,046 Y780F probably benign Het
Plcg2 A G 8: 117,605,249 Y858C probably benign Het
Prkca A T 11: 108,012,684 N287K probably damaging Het
Qsox2 A C 2: 26,214,062 S484A probably damaging Het
Reep4 G A 14: 70,548,197 G225D possibly damaging Het
Scn4a T C 11: 106,339,386 E532G probably damaging Het
Sfi1 A ATCTTCCCAAAGCCAGTGC 11: 3,153,384 probably benign Het
Slc23a1 A G 18: 35,622,510 probably null Het
Sowaha C T 11: 53,479,528 R127Q probably benign Het
Spag9 T C 11: 94,100,135 W626R probably damaging Het
Trim45 A G 3: 100,925,471 D340G probably damaging Het
Vmn1r193 A T 13: 22,219,555 F89Y probably damaging Het
Zfp507 T C 7: 35,775,996 N931D probably damaging Het
Other mutations in Olfr1262
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Olfr1262 APN 2 90003021 missense possibly damaging 0.65
IGL03303:Olfr1262 APN 2 90002466 missense possibly damaging 0.88
R1216:Olfr1262 UTSW 2 90002478 missense probably benign 0.23
R1256:Olfr1262 UTSW 2 90002567 missense possibly damaging 0.61
R1860:Olfr1262 UTSW 2 90003146 missense probably benign 0.26
R1864:Olfr1262 UTSW 2 90002481 missense probably benign 0.02
R1918:Olfr1262 UTSW 2 90002574 missense probably benign 0.12
R2192:Olfr1262 UTSW 2 90002430 missense probably damaging 0.99
R3024:Olfr1262 UTSW 2 90003240 missense probably damaging 1.00
R4155:Olfr1262 UTSW 2 90002660 missense probably benign 0.35
R4956:Olfr1262 UTSW 2 90002843 missense probably benign 0.33
R5804:Olfr1262 UTSW 2 90002988 missense possibly damaging 0.91
R6766:Olfr1262 UTSW 2 90002532 missense probably benign 0.06
R7674:Olfr1262 UTSW 2 90003045 missense probably damaging 0.99
Z1176:Olfr1262 UTSW 2 90003048 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TTCACCTCAGGGACCAGAAG -3'
(R):5'- AGCCATTGAAGGATATGGTGC -3'

Sequencing Primer
(F):5'- TCACCTCAGGGACCAGAAGTAATAAG -3'
(R):5'- CCATTGAAGGATATGGTGCTCTTCTC -3'
Posted On2016-07-22